How to Write a Synthesis Essay

Matt Ellis

Synthesis essays are common assignments in both high school and university, but that doesn’t mean they’re easy or that everyone knows how to write them. In this guide, we discuss everything you need to know in order to write one yourself. We talk about synthesis essay structure and offer some general tips, plus we clarify any confusion between a synthesis essay versus an argumentative essay.

Cite your sources with confidence Grammarly helps you avoid plagiarism Write with Grammarly

What is a synthesis essay?

A synthesis essay is a type of essay that combines points, data, and evidence from multiple sources and turns them into one idea that the writing revolves around. In other words, the writer synthesizes their own idea using other sources’ research and points. Usually, synthesis essays are a type of analytical essay , but they have crossover with other types of essays as well, such as argumentative essays .

The central idea in a synthesis essay is represented by the thesis statement , a sentence that succinctly explains the main point of the essay. In a synthesis essay, this “new” idea usually consolidates the main points and/or findings of other sources.

Synthesis essay structure

Creating a solid synthesis essay structure is one of the hardest parts of writing a synthesis essay. Unlike most other essay outlines , an outline for a synthesis essay has to include points from multiple sources, and such combinations don’t always have a logical or chronological sequence. To help you out, here are three strategies for creating a synthesis essay structure and sample outlines that you can use as templates.

Synthesis essay structure 1: By topic

The first kind of synthesis essay structure involves discussing each topic individually, mentioning each source’s perspective on it, and then moving on to the next topic. This approach lets you compare or join together points made by different sources about the same specific topic.

Structuring your synthesis essay by topic works best for more complicated ideas with different aspects that should be explored individually.

Example outline:

I. Introduction A. Thesis statement

II. Topic 1 A. Source A discussing Topic 1 1. A point or piece of evidence/data from Source A about Topic 1 2. Another point or piece of evidence/data from Source A about Topic 1 3. [Etc.]

B. Source B discussing Topic 1 1. A point or piece of evidence/data from Source B about Topic 1 2. [Etc.] 

III. Topic 2 A. Source A discussing Topic 2 B. [Etc.] 

IV. Topic 3 A. [Etc.]

[You can keep going like this with as many topics as you need.]

V. Conclusion A. Revisit thesis statement

Synthesis essay structure 2: By source

Alternatively, you can organize your synthesis essay structure by source: You discuss the main points of one source together and then move on to another source. This approach lets you compartmentalize the main points according to where they come from but ultimately bring together the main points from different sources.

Structuring your synthesis essay by source works best when you want to emphasize the sources themselves over the points they make. For example, if you were using this type of structure for an argumentative essay, you might want to fully discuss the source you’re refuting before making your counterargument.

II. Source 1 A. Source 1 discussing Topic A 1. A point or piece of evidence/data from Source 1 about Topic A 2. Another point or piece of evidence/data from Source 1 about Topic A 3. [Etc.]

B. Source 1 discussing Topic B 1. A point or piece of evidence/data from Source 1 about Topic B 2. [Etc.]

III. Source 2 A. Source 2 discussing Topic A B. Source 2 discussing Topic B C. [Etc.]

IV. Source 3 A. [Etc.]

[You can keep going like this for all your sources.]

V. Conclusion 1. Revisit thesis statement

Synthesis essay structure 3: Combine

The synthesis essay structures above are by no means set in stone. You’re free to adapt or modify them however you need and can even combine them.

For example, what if there’s a special source that stands out from the others? You could begin your synthesis essay by discussing each topic individually so that your reader understands the issue. Then you could switch it up and include a section just for that one special source, explaining that source’s stance on the previously discussed topics.

3 tips for writing a synthesis essay

1 come up with a strong thesis statement.

As mentioned above, a thesis statement is a single sentence that briefly explains the main point of your essay. In a synthesis essay, the thesis statement should effectively bring together the ideas and points from multiple other sources.

Part of writing a strong thesis statement comes from choosing your essay topic . Pick a topic that is broad enough to have sufficient research and enough other sources discussing it but specific enough that you can cover everything.

As for writing the actual thesis statement, a helpful method is to phrase your topic as a question and then answer it. The answer could be a good start to your thesis statement sentence. For example, let’s say your topic is how Denmark came to be first in clean energy. You could phrase the question and answer as:

Q: “Why is Denmark the leading country in renewable energy?”

A: “Denmark is first in clean energy thanks in part to energy conservation from district heating, combined heat-and-power stations, and its use of small, locally based power plants instead of larger ones.”

That answer could double as your thesis statement and mentions some of the other types of sources you use in your essay.

2 Read all the sources carefully

A synthesis essay is only as good as its sources. The nature of a synthesis essay is to build on its sources, so you need to choose the best ones and understand each of them thoroughly.

Make sure you comb through your sources so you don’t miss a good point or piece of evidence you could use in your essay. It helps to come up with your thesis statement early on so you can look for points related to it when you’re reading.

3 Write a gripping introduction

One of the keys to any good essay, synthesis or not, is a strong opening. This is partially determined by your thesis statement, but the other sentences in your introduction also make a big impact.

For starters, you can learn how to write a hook . In writing, a hook is something that grabs the reader’s attention and makes them want to keep reading. Hooks can essentially be anything interesting. Some common strategies for writing hooks include using personal anecdotes to create an emotional connection or providing exciting facts/statistics that the reader might not know.

Additionally, the introduction should also explain the scope of your topic and set the scene for people who aren’t familiar with it. The goal of the introduction is to prepare the reader for what follows so that afterward you can transition straight into making your points.

Synthesis essay vs. argumentative essay

Synthesis essays are often compared to argumentative essays, which attempt to refute, debunk, or criticize existing ideas or other research. The truth is that the two are not mutually exclusive. Although synthesis essays tend to be analytical or expository, they can also be argumentative.

A synthesis essay is any essay that combines ideas from multiple sources to create a new unified idea. If that new idea is a rebuttal to a preexisting idea and the entire essay is written as a critique, then the essay would be both synthesis and argumentative.

Synthesis essay FAQs

A synthesis essay is a type of essay that combines points, data, and evidence from multiple sources and turns them into one unified idea. In other words, the writer synthesizes their own idea using other sources’ research and ideas.

What is a good synthesis essay structure?

Traditionally, the common approaches to creating a synthesis essay structure are organizing by topic or organizing by source. The former means you discuss each source’s perspective on a topic before moving to the next topic; the latter means you discuss one source’s stance on each topic and then move to another source. You can also create a hybrid structure of the two for particular subjects.

What is the difference between a synthesis essay and an argumentative essay?

Synthesis essays are often contrasted with argumentative essays, but the truth is that the two are not mutually exclusive. For example, an argumentative essay can use the format of a synthesis essay—combining points from multiple sources to form a new unified idea—in order to refute a preexisting idea.

what is the synthesis in an essay

The Writing Center of Princeton

Synthesis Essays: A Step-by-Step How-To Guide

A synthesis essay is generally a short essay which brings two or more sources (or perspectives) into conversation with each other.

The word “synthesis” confuses every student a little bit. Fortunately, this step-by-step how-to guide will see you through to success!

Here’s a step-by-step how-to guide, with examples, that will help you write yours.

Before drafting your essay:

After reading the sources and before writing your essay, ask yourself these questions:

  • What is the debate or issue that concerns all of the writers? In other words, what is the question they are trying to answer?
  • On what points do they agree?
  • On what points do they disagree?
  • If they were having a verbal discussion, how would writer number one respond to the arguments of writer number two?

In a way, writing a synthesis essay is similar to composing a summary. But a synthesis essay requires you to read more than one source and to identify the way the writers’ ideas and points of view are related.

Sometimes several sources will reach the same conclusion even though each source approaches the subject from a different point of view.

Other times, sources will discuss the same aspects of the problem/issue/debate but will reach different conclusions.

And sometimes, sources will simply repeat ideas you have read in other sources; however, this is unlikely in a high school or AP situation.

To better organize your thoughts about what you’ve read, do this:

  • Identify each writer’s thesis/claim/main idea
  • List the writers supporting ideas (think topic sentences or substantiating ideas)
  • List the types of support used by the writers that seem important. For example, if the writer uses a lot of statistics to support a claim, note this. If a writer uses historical facts, note this.

There’s one more thing to do before writing: You need to articulate for yourself the relationships and connections among these ideas.

Sometimes the relationships are easy to find. For example, after reading several articles about censorship in newspapers, you may notice that most of the writers refer to or in some way use the First Amendment to help support their arguments and help persuade readers. In this case, you would want to describe the different ways the writers use the First Amendment in their arguments. To do this, ask yourself, “How does this writer exploit the value of the First Amendment/use the First Amendment to help persuade or manipulate the readers into thinking that she is right?

Sometimes articulating the relationships between ideas is not as easy. If you have trouble articulating clear relationships among the shared ideas you have noted, ask yourself these questions:

  • Do the ideas of one writer support the ideas of another? If so, how?
  • Do the writers who reach the same conclusion use the same ideas in their writing? If not, is there a different persuasive value to the ideas used by one writer than by the other?
  • Do the writers who disagree discuss similar points or did they approach the subject from a completely different angle and therefore use different points and different kinds of evidence to support their arguments?
  • Review your list of ideas. Are any of the ideas you have listed actually the same idea, just written in different words?

what is the synthesis in an essay

How to Write a Synthesis Essay: Your Guide From Start to Finish

what is the synthesis in an essay

Today, we're swamped with information, like reading 174 newspapers every day. It comes from all over—news, social media, science, and more. This flood might make you feel overwhelmed and lost in a sea of facts and opinions. But being able to make sense of it all is crucial.

In this guide, we'll show you steps for choosing the right topic and organizing your essay. Let's dive in and learn how to turn scattered facts into powerful essays that really stand out. If you're looking for assistance in writing a paper, you can consider the option to order essay from our expert writing service.

What Is a Synthesis Essay

Synthesis essay is an academic assignment where you take information from several sources and combine it to create a new, unified argument. Throughout the essay, you'll weave in evidence and insights from your sources to support your thesis, explaining how each source contributes to your overall argument.

Synthesis essays are commonly assigned in high school and undergraduate courses across various disciplines. They are a great way to develop critical thinking, research, and writing skills. They are particularly useful when a topic has multiple angles or ongoing debates, as they train you to analyze information objectively and form your own well-supported conclusions.

If you're struggling with this task, just ask us to ' write paper for me ,' and we'll handle your assignment for you.

How to Write a Synthesis Essay with Easy Steps

Writing a synthesis essay requires a methodical approach to blend information from different sources into a strong and persuasive argument. Here are steps to help you along the way.

1. Choose Your Topic:

  • Make sure it's broad enough to allow for multiple perspectives but specific enough for focused research.
  • Look for topics with ongoing debates or with room for your own interpretation.

2. Research and Gather Sources:

  • Use credible sources like academic journals, books, and reputable news websites. Aim for a variety of perspectives to ensure a well-rounded analysis.
  • Take notes while researching! Focus on key points, evidence, and the author's main arguments.

3. Develop Your Thesis Statement:

  • This is the central argument of your essay, informed by your research.
  • It should clearly state how the different sources will be used to create a unified perspective.

4. Structure Your Essay:

  • Introduction: Briefly introduce the topic, highlight the various perspectives, and present your thesis statement.
  • Topic Sentence: Briefly introduce the point you'll be making in this paragraph.
  • Analysis & Evidence: Integrate information from your sources, explaining how they support your point. Use in-text citations and proper formatting.
  • Commentary: Explain the significance of the source material and how it contributes to your overall argument.
  • Conclusion: Summarize your main points and reiterate the importance of your thesis statement. You can also offer further implications or remaining questions on the topic.

5. Write and Revise:

  • Draft your essay, ensuring smooth transitions between your ideas and source integration.
  • Revise for clarity, proper citation format, and strong argument flow.

For a more detailed explanation on how to write a conclusion , check out our special guide.

Synthesis Essay Example

Here are a couple of synthesis essay examples that demonstrate how to apply the synthesis process in real life. See how they tackle a wide range of issues by drawing on diverse perspectives.

Ready to Transform Your Synthesis Essay from Bland to Grand?

Let's tap into the magic of our expert wordsmiths, who will create an essay that dances with ideas and dazzles with creativity!

Synthesis Essay Thesis Statement

A strong thesis statement for a synthesis essay is more nuanced than a simple opinion. It acknowledges the complexities of the topic and positions your essay as a bridge between existing perspectives. Here's how to craft an effective thesis:

  • Avoid extremes: Statements like "Social media is destroying society" are too broad and lack specific arguments. Saying "Taxes are bad" ignores potential benefits or complexities.
  • Acknowledge Nuance: Show you understand different viewpoints by using qualifiers like "often," "in some cases," or "to a certain extent."
  • Bridge the Gap: Your thesis should connect various source viewpoints to create a new perspective.

Example transformation:

Original (weak): Video games are a waste of time.

Improved: While video games can be a source of leisure, their excessive use can negatively impact academic performance and social interaction. (This acknowledges the entertainment value while highlighting potential drawbacks.)

  • Your thesis should be specific to your topic and the sources you'll use.
  • It should be clear, concise, and directly address the prompt.
  • It sets the stage for your argument by outlining the connections between your chosen sources.

Synthesis Essay Checklist

Writing a strong synthesis essay requires careful attention to detail. Use this checklist to ensure you've covered all the bases:

Criteria Questions
Clear Thesis Statement 📜 Does your thesis clearly state how you'll use multiple sources to create a unified perspective?
Source Integration 🔗 Do you seamlessly weave evidence and insights from your sources throughout the essay?
Balanced Analysis ⚖️ Do you acknowledge different viewpoints and offer fair treatment to all sources?
Strong Argument Flow 🌊 Do your ideas transition smoothly, building a cohesive argument towards your thesis?
Grammar and Punctuation ✅ Is your essay free of grammatical errors and typos?
Word Count 📏 Does your essay meet the required word count?

Synthesis Essay Format

A well-structured synthesis essay guides the reader through your analysis of multiple sources and effectively builds your argument. Here's a breakdown of the typical format:

  • Double-space your essay unless otherwise instructed.
  • Use a standard font (e.g., Times New Roman, Arial) and font size (e.g., 12 pt).
  • Maintain consistent margins (e.g., 1 inch).
  • Include page numbers in the top right corner (optional, but often recommended).
  • Introduction (10-15% of word count):
  • Body Paragraphs (60-70% of word count)
  • Conclusion (10-15% of word count):
  • The specific word count breakdown might vary based on your assignment instructions.
  • Always follow the formatting guidelines provided by your instructor.

For a deeper understanding of a compare and contrast essay , including format and writing process, consult our dedicated article.

Explanatory vs. Argumentative Synthesis Essays

In synthesis writing, there are two main types: explanatory and argumentative. While both involve analyzing multiple sources, their ultimate goals differ. Here's a breakdown of the key distinctions between explanatory and argumentative synthesis essays:

Criteria Explanatory Synthesis Argumentative Synthesis
Goal 🎯 To clearly explain and compare/contrast different perspectives on a complex topic. To develop a specific argument on a debatable topic, supported by evidence from multiple sources.
Focus 🔍 Presents a balanced overview of various viewpoints without taking a strong personal stance. Persuades the reader by integrating source material that strengthens your chosen position.
Structure 🏗️ Highlights key arguments, evidence, and conclusions from each source, demonstrating their connections and potential contradictions. Selectively emphasizes information from sources that align with your argument, while acknowledging and addressing opposing viewpoints.
Thesis Statement 📜 Outlines the key points of comparison or contrast between the sources. States your position on the topic and outlines how the sources will be used to support your claim.
Example 💡 "This essay will explore the different approaches to tackling climate change, analyzing the proposals put forth by environmental scientists, economists, and social scientists." "While some argue for a complete ban on social media, a more measured approach that encourages responsible use and promotes digital literacy is a more effective solution."

And if you're keen on knowing how to write an informative essay , we've got you covered on that, too!

Synthesis Essay Topics

Picking essay topics is just the beginning. To write a great synthesis essay, you need to carefully evaluate and connect different sources to build a strong argument or viewpoint. Here's a step-by-step infographic guide to help you choose the right synthesis essay topics wisely.

There are myriads of essay topics , so how do you choose the right one? Don’t waste your time, here we offer some great ideas:

  • What role does effective communication play in resolving international conflicts?
  • Are video games a legitimate form of art?
  • Does standardized testing hinder critical thinking skills?
  • Is cultural appropriation a valid concern or does it stifle artistic exchange?
  • Should economic growth outweigh environmental sustainability and social welfare?
  • Is the traditional family structure the best model for child-raising?
  • Should social media platforms curb misinformation?
  • Is artificial intelligence a boon for scientific discovery, or does it pose ethical challenges?
  • Is globalization more about economic prosperity or cultural homogenization?
  • Should controversial historical monuments be preserved?
  • Can renewable energy alone combat climate change, or are more drastic measures necessary?
  • Should artistic expression face censorship or enjoy complete freedom?
  • How can national security and individual privacy be balanced in the digital age?
  • Does the cost of higher education hinder social mobility?
  • Does automation threaten jobs or create new opportunities?

If you’re interested in persuasive essays topics , this guide's got your back.

Concluding Thoughts

Writing a synthesis essay is a great way to learn about a topic. It lets you explore different viewpoints and see how they fit together. This guide gives you the steps to follow for a strong essay. Remember, the goal is to use what you learn from your sources to create your own unique understanding. So next time you have a complex topic, give a synthesis essay a try! You might be surprised by what you learn.

Want an Essay that Sings, Sparkles, and Stuns?

Fear not! Our expert wordsmiths are here to turn your thoughts into a symphony of ideas!

How Should You Conclude a Synthesis Essay?

Daniel Parker

Daniel Parker

is a seasoned educational writer focusing on scholarship guidance, research papers, and various forms of academic essays including reflective and narrative essays. His expertise also extends to detailed case studies. A scholar with a background in English Literature and Education, Daniel’s work on EssayPro blog aims to support students in achieving academic excellence and securing scholarships. His hobbies include reading classic literature and participating in academic forums.

what is the synthesis in an essay

is an expert in nursing and healthcare, with a strong background in history, law, and literature. Holding advanced degrees in nursing and public health, his analytical approach and comprehensive knowledge help students navigate complex topics. On EssayPro blog, Adam provides insightful articles on everything from historical analysis to the intricacies of healthcare policies. In his downtime, he enjoys historical documentaries and volunteering at local clinics.

How to Write a Critical Thinking Essay

  • PRO Courses Guides New Tech Help Pro Expert Videos About wikiHow Pro Upgrade Sign In
  • EDIT Edit this Article
  • EXPLORE Tech Help Pro About Us Random Article Quizzes Request a New Article Community Dashboard This Or That Game Happiness Hub Popular Categories Arts and Entertainment Artwork Books Movies Computers and Electronics Computers Phone Skills Technology Hacks Health Men's Health Mental Health Women's Health Relationships Dating Love Relationship Issues Hobbies and Crafts Crafts Drawing Games Education & Communication Communication Skills Personal Development Studying Personal Care and Style Fashion Hair Care Personal Hygiene Youth Personal Care School Stuff Dating All Categories Arts and Entertainment Finance and Business Home and Garden Relationship Quizzes Cars & Other Vehicles Food and Entertaining Personal Care and Style Sports and Fitness Computers and Electronics Health Pets and Animals Travel Education & Communication Hobbies and Crafts Philosophy and Religion Work World Family Life Holidays and Traditions Relationships Youth
  • Browse Articles
  • Learn Something New
  • Quizzes Hot
  • Happiness Hub
  • This Or That Game
  • Train Your Brain
  • Explore More
  • Support wikiHow
  • About wikiHow
  • Log in / Sign up
  • Education and Communications
  • College University and Postgraduate
  • Academic Writing

How to Write a Synthesis Essay

Last Updated: April 7, 2024 Fact Checked

This article was co-authored by Christopher Taylor, PhD . Christopher Taylor is an Adjunct Assistant Professor of English at Austin Community College in Texas. He received his PhD in English Literature and Medieval Studies from the University of Texas at Austin in 2014. There are 11 references cited in this article, which can be found at the bottom of the page. This article has been fact-checked, ensuring the accuracy of any cited facts and confirming the authority of its sources. This article has been viewed 1,126,315 times.

Writing a synthesis essay requires the ability to digest information and present it in an organized fashion. While this skill is developed in high school and college classes, it translates to the business and advertising world as well. Scroll down to Step 1 to begin learning how to write a synthesis essay.

Examining Your Topic

Step 1 Understand the concept of a synthesis essay.

  • Argument synthesis: This type of essay has a strong thesis statement that presents the writer's point of view. It organizes relevant information gathered from research in a logical manner to support the thesis' point of view. Business white papers known as position papers often take this form. This is the type of synthesis essay that students will write during the AP test.
  • Review: Often written as a preliminary essay to an argument synthesis, a review essay is a discussion of what has been written previously on a topic, with a critical analysis of the sources covered. Its unstated thesis is usually that more research needs to be done in that area or that the topic problem has not been adequately addressed. This type of paper is common in social science classes and in medicine.
  • Explanatory/background synthesis: This type of essay helps readers understand a topic by categorizing facts and presenting them to further the reader's understanding. It does not advocate a particular point of view, and if it has a thesis statement, the thesis is a weak one. Some business white papers take this form, although they are more likely to have a point of view, if understated.

Step 2 Choose a topic suitable for a synthesis essay.

  • Example of a broad topic narrowed down into a reasonable synthesis essay topic: Instead of the broad topic of Social Media, you could discuss your view on the effects texting has had on the English language.
  • If you've been assigned a topic as part of a class, make sure you read the prompt carefully and fully understand it.

Step 3 Choose and read your sources carefully.

  • Keep in mind that it's better to do three sources well than to do five sources incompletely.
  • Annotate each source by writing notes in the margins. This allows you to keep track of your train of thought, developing ideas, etc.

Step 4 Develop a thesis...

  • Example: Texting has had a positive impact on the English language as it has helped the millennial generation create their own form of the language.

Step 5 Re-read your source material for items to support your thesis.

  • If you wish to take on a claim by an opponent of your idea, and to poke holes in it, you should also find some ideas or quotes that go against your thesis statement, and plan ways to disprove them. This is called a concession, refutation, or rebuttal, which can strengthen your argument if you do it well.
  • Example : For the thesis statement listed above, excellent sources would include quotes from linguists discussing the new words that have developed through 'text-speak', statistics that show the English language has evolved with almost every generation, and facts that show students still have the ability to write with the use of grammar and spelling (which your opponents would bring up as the main reason texting has had a negative effect on the English language).

Outlining Your Essay

Step 1 Outline the structure of your thesis.

  • The introductory paragraph: 1. An introductory sentence that acts as a hook, capturing the reader's interest. 2. Identification of the issue you will be discussing. 3. Your thesis statement.
  • The body paragraphs: 1. Topic sentence that gives one reason to support your thesis. 2. Your explanation and opinion of the topic sentence. 3. Support from your sources that backs up the claim you just made. 4. Explanation of the significance of the source(s).
  • The conclusion paragraph: 1. State further significance of your topic from the evidence and reasons you discussed in the essay. 2. A profound thought or thoughtful ending for your paper.

Step 2 Use a more creative structure to present your thesis.

  • Example/illustration. This may be a detailed recount, summary, or direct quote from your source material that provides major support for your point of view. You may use more than one example or illustration, if your paper calls for it. You should not, however, make your paper a series of examples at the expense of supporting your thesis.
  • Straw man. With this technique, you present an argument opposed to the argument stated in your thesis, then show the weaknesses and flaws of the counter-argument. This format shows your awareness of the opposition and your readiness to answer it. You present the counter-argument right after your thesis, followed by the evidence to refute it, and end with a positive argument that supports your thesis. [5] X Research source
  • Concession. Essays with concessions are structured similar to those using the straw man technique, but they acknowledge the validity of the counter-argument while showing that the original argument is stronger. This structure is good for presenting papers to readers who hold the opposing viewpoint.
  • Comparison and contrast. This structure compares similarities and contrasts differences between two subjects or sources to show the facets of both. Writing an essay with this structure requires a careful reading of your source material to find both subtle and major points of similarity and difference. This kind of essay can present its arguments source-by-source or by points of similarity or difference.

Step 3 Create an outline appropriate for a background or review synthesis essay.

  • Summary. This structure presents summaries of each of your relevant sources, making a progressively stronger argument for your thesis. It provides specific evidence to support your point of view, but usually omits presenting your own opinions. It's most commonly used for background and review essays.
  • List of reasons. This is a series of sub-points that flow from the main point of your paper as stated in its thesis. Each reason is supported with evidence. As with the summary method, reasons should become progressively more important, with the most important reason last.

Writing Your Essay

Step 1 Write your first draft according to your outline.

  • Your essay should have an introductory paragraph that includes your thesis , a body to present evidence that supports your thesis, and a conclusion that summarizes your point of view.

Step 2 Write in the third person.

  • Lengthy quotes of three lines or more should generally be set off as block quotes to better call attention to them. [7] X Trustworthy Source Purdue Online Writing Lab Trusted resource for writing and citation guidelines Go to source

Finalizing Your Essay

Step 1 Revise your essay.

  • Ask someone else to proofread your paper. The saying “two heads are better than one” still holds true. Ask a friend or colleague what would they add or remove from the paper. Most importantly, does your argument make sense, and is it clearly supported by your sources?

Step 2 Proofread your paper.

  • Read the paper aloud to guarantee that you don't accidentally add in or take out words when reading in your head.
  • If you can, get a friend or classmate to proofread your essay as well.

Step 3  Cite your...

  • Example of citing in an AP synthesis essay: McPherson claims “texting has changed the English language in a positive way--it has given a new generation their own unique way to communicate” (Source E).
  • For college essays, you'll most likely use MLA format. Whichever format you use, be consistent in its use. You may also be asked to use APA or Chicago style.

Step 4 Title your essay.

  • Example title: : English and the iPhone: Exploring the Benefits of 'Text-Speak'

Outline Template

what is the synthesis in an essay

Community Q&A

Community Answer

  • Just as your title should fit your essay instead of writing your essay to fit the title, your thesis, once chosen, should direct your subsequent research instead of subsequent research altering your thesis � unless you find you've adopted an unsupportable thesis. Thanks Helpful 21 Not Helpful 8

what is the synthesis in an essay

You Might Also Like

Write an Essay

  • ↑ https://success.uark.edu/get-help/student-resources/synthesis-paper.php
  • ↑ https://www.unr.edu/writing-speaking-center/student-resources/writing-speaking-resources/mapping-a-synthesis-essay
  • ↑ https://www.bgsu.edu/content/dam/BGSU/learning-commons/documents/writing/synthesis/planning-synthesis-essay.pdf
  • ↑ https://writingcenterofprinceton.com/synthesis-essays-a-step-by-step-how-to-guide/
  • ↑ https://owl.excelsior.edu/argument-and-critical-thinking/logical-fallacies/logical-fallacies-straw-man/
  • ↑ https://writingcommons.org/section/rhetoric/rhetorical-stance/point-of-view/third-person-point-of-view/
  • ↑ https://owl.purdue.edu/owl/research_and_citation/mla_style/mla_formatting_and_style_guide/mla_formatting_quotations.html
  • ↑ https://owl.purdue.edu/owl/general_writing/the_writing_process/proofreading/steps_for_revising.html
  • ↑ https://owl.purdue.edu/owl/general_writing/the_writing_process/proofreading/proofreading_suggestions.html
  • ↑ https://www.edhs.org/ourpages/auto/2010/5/17/41759867/Synthesis%20Essay%20Introduction.pdf
  • ↑ https://writing.umn.edu/sws/assets/pdf/quicktips/titles.pdf

About This Article

Christopher Taylor, PhD

To write a synthesis essay, start by coming up with a thesis statement that you can support using all of the sources you've read for your essay. For example, your thesis statement could be "Texting has had a positive impact on the English language." Once you've got your thesis, go through your sources to find specific quotes, facts, and statistics that back up your claim. Structure your essay so it has an introduction that includes your thesis statement, a body that includes your arguments and evidence, and a conclusion that wraps everything up. For more tips on structuring your synthesis essay, read on! Did this summary help you? Yes No

  • Send fan mail to authors

Reader Success Stories

Anonymous

Aug 8, 2016

Did this article help you?

Anonymous

Adrian Mastrocola

Sep 29, 2016

Emmanuel Amoatey Djaba

Emmanuel Amoatey Djaba

Nov 26, 2016

Anna VonLeader

Anna VonLeader

Jun 6, 2016

Urvi Patel

May 7, 2017

Do I Have a Dirty Mind Quiz

Featured Articles

Protect Yourself from Predators (for Kids)

Trending Articles

Best Excuses to Use to Explain Away a Hickey

Watch Articles

Clean the Bottom of an Oven

  • Terms of Use
  • Privacy Policy
  • Do Not Sell or Share My Info
  • Not Selling Info

wikiHow Tech Help Pro:

Develop the tech skills you need for work and life

  • Link to facebook
  • Link to linkedin
  • Link to twitter
  • Link to youtube
  • Writing Tips

How to Write a Synthesis Essay

How to Write a Synthesis Essay

4-minute read

  • 31st May 2023

Are you writing a synthesis essay? This is a paper that combines information from a variety of sources to form a new idea. Essentially, you’re synthesizing existing concepts and arguments to create something original.

As a student, you’ll probably have to write a synthesis essay at some point. Read on for our step-by-step guide on how to write one effectively.

Step 1. Define Your Idea or Argument

If you haven’t done so already, decide on a topic to write about. Read up about it using a variety of credible sources and make detailed notes while you research. Make sure you keep track of the sources you decide to pull information from so that you can cite them properly later.

Make a list of key points from your research. Once you have a good selection of material to work with, start developing your own idea or argument. This will be the focus of your essay.

Step 2. Create an Outline

Synthesis essays generally follow this format: an introduction, a handful of main body paragraphs, and a conclusion. It’s a good idea to come up with an essay plan before you start writing so that you can keep things organized while you work.

The outline is mainly helpful for deciding what to include in your body paragraphs. Decide what supporting points (and counterarguments ) from your research you want to include, and which order you want to discuss them in. You should have enough information to flesh out one paragraph for each point.

Step 3. Write Your Introduction

In your introduction, you should open with something that hooks the reader and captures their attention. Then, state your argument or idea (i.e., your thesis statement) and briefly summarize the material you’ll be including in your essay. You should also include any relevant background information here.

Step 4. Write the Body Paragraphs

Using your outline, discuss each point from your source material in more depth, devoting a body paragraph to each. Explain the information from the outside source, including appropriate citations, and discuss how it connects with your idea.

It’s a good idea to mostly focus on points that support your argument, but you should also include a paragraph with a counterargument or two. This means discussing a perspective that doesn’t necessarily align with your idea, and then explaining why your argument still works.

Step 5. Tie It All Together With a Conclusion

The conclusion should leave the reader feeling convinced of your idea. Restate your point clearly and summarize the main points you’ve discussed. You could also offer any concluding reflections on the topic.

Different Types of Synthesis Essays

While you can follow our steps for any type of synthesis essay, yours will probably fall under one of two categories: explanatory or argumentative.

Find this useful?

Subscribe to our newsletter and get writing tips from our editors straight to your inbox.

Argumentative essays are as they sound – they present an argument. With an argumentative essay, you’ll take a more definitive stance on something and use your supporting material to persuade the reader.

Explanatory essays don’t necessarily take a side one way or the other. Rather, they focus on developing and explaining a concept thoroughly. Knowing which type of essay you’re writing will help you to gather more effective source material for your purpose.

Cite Your Sources

Since synthesis essays are particularly dependent on outside material, it’s especially important that you cite your sources correctly. Familiarize yourself with your referencing system before you start researching so you know what information you need to keep track of, and include appropriate citations whenever you use someone else’s work.

At the end of the essay, you’ll need to compile your sources into a reference list following the requirements of your style guide.

Summary: Writing a Synthesis Essay

Hopefully, this post has helped you to feel more confident in writing a synthesis essay. Choose a topic first, do your research, keep track of your sources, and develop an argument or idea. From there, you can organize your thoughts into an outline and get to writing!

Once you’ve created a first draft, make sure you send it our way! We’ll check it for errors in grammar, spelling, referencing, and more. Try it out for free today.

Frequently Asked Questions

What is a synthesis essay.

A synthesis essay gathers ideas and viewpoints from several different sources and ties them together to form a new concept.

How long is a synthesis essay?

Synthesis essays usually follow the five-paragraph format, with an introduction, three main body paragraphs discussing different points, and a conclusion.

Share this article:

Post A New Comment

Got content that needs a quick turnaround? Let us polish your work. Explore our editorial business services.

5-minute read

Free Email Newsletter Template (2024)

Promoting a brand means sharing valuable insights to connect more deeply with your audience, and...

6-minute read

How to Write a Nonprofit Grant Proposal

If you’re seeking funding to support your charitable endeavors as a nonprofit organization, you’ll need...

9-minute read

How to Use Infographics to Boost Your Presentation

Is your content getting noticed? Capturing and maintaining an audience’s attention is a challenge when...

8-minute read

Why Interactive PDFs Are Better for Engagement

Are you looking to enhance engagement and captivate your audience through your professional documents? Interactive...

7-minute read

Seven Key Strategies for Voice Search Optimization

Voice search optimization is rapidly shaping the digital landscape, requiring content professionals to adapt their...

Five Creative Ways to Showcase Your Digital Portfolio

Are you a creative freelancer looking to make a lasting impression on potential clients or...

Logo Harvard University

Make sure your writing is the best it can be with our expert English proofreading and editing.

Writing Synthesis Essay: Make it Easy with Our Comprehensive Guide

image

Table of contents

  • 1 Purpose and Objectives of a Synthesis Essay
  • 2.1 Explanatory Synthesis Essay
  • 2.2 Argument Synthesis Essay
  • 2.3 Review Synthesis Essay
  • 3 Common Topics Encountered in Synthesis Essays
  • 4.1 Conduct Thorough Research
  • 4.2 Look from Diverse Perspectives
  • 4.3.1 Chronological Method
  • 4.3.2 Thematic Method
  • 4.3.3 Point-by-point Method
  • 5 Make a Synthesis Essay Outline to Structure Content
  • 6.1 Critically Analyze Sources and Identify Their Relevance to the Thesis Statement
  • 7.1 Support Your Arguments
  • 7.2 Address Counterarguments
  • 8.1 Bibliography
  • 9 Proofread and Edit Your Essay
  • 10 Bottom line
  • 11.1 How long should a synthesis essay be?
  • 11.2 How many paragraphs are in a synthesis essay?
  • 11.3 Is a synthesis essay argumentative?
  • 11.4 Does a synthesis essay have a counterargument?

Being a student is a challenging task, as you have to handle different types of essays, particularly synthesis essays. What is a synthesis essay? Such creative writing helps students to develop research skills, conduct a thorough analysis and improve their writing skills. Also, it boosts their abilities to deliver original ideas, arguments, and clear explanations of particular viewpoints. Students might often receive such writing tasks for the AP English language exam. We know how challenging it can be for them to write a synthesis essay.

With this in mind, we uncover the key points of synthesis writing in this review, which are the following:

  • We’ll define the main traits of this essay type
  • What are the different types?
  • We collect the best advice on how to write a synthesis essay.
  • and prepared the list of synthesis essay topic examples.

If you find it difficult to start your synthesis essay, you can get help from our PapersOwl service. The best experts in academic writing await you to bring up a good synthesis essay with a high assessment grade.

Purpose and Objectives of a Synthesis Essay

First and foremost, it is vital to understand the definition of a synthesis essay. It is a type of essay in which you should provide justified arguments, ideas, or statements based on a particular point of view. Composing a synthesis essay requires a lot of time and effort. You must analyze many credible sources to collect specific data and create a unique research paper. Synthesizing sources has to do with analyzing them, but not vice versa. You should provide an in-depth analysis of each source and then combine the similarities or differences between them into one coherent and well-structured essay. The next section uncovers this matter.

Key Features and Components

A synthesis essay counts a few types depending on the objectives to reveal. But essential synthesis essay components are the same and consist of three main parts: introduction, main body, and conclusion. The introductory paragraph should be catchy and highlight the main points of your paperwork due to a good thesis statement. The main body should include at least three paragraphs separated by exposing different thoughts, arguments, or explanations. The conclusion should also leave a spot for meditating for your reader on what you have disclosed in it. Further, we explain three types of synthesis papers and their specifications.

Explanatory Synthesis Essay

This type of synthesis essay involves disclosing various facts, views, or points. That’s why it is required to explore many reliable sources to get as much relevant information about a topic under investigation as possible. Thus, a writer can explain the emergence of certain points of view and facts. This writing task helps high school and college students do deep research, compare facts and perspectives, and deliver a detailed synthesis analysis essay. It is essential to complement each statement with specific evidence and statistical data. This will underline the relevance of the information introduced in an essay and make it meaningful and reasonable.

Argument Synthesis Essay

When writing argumentative essays , one must choose a specific topic and present arguments supporting or opposing viewpoints. This writing assignment incorporates two objectives: gather and systemize information revealing the main topic and argue them from your perspective. It requires creativity and deep knowledge of the field and aspect you must put on paper. Writing an argumentative essay is not an easy task. You should stick to a particular perspective and move on to exposing it. It is crucial to provide enough facts and proof to convince your reader that your viewpoint is noteworthy.

Review Synthesis Essay

Review synthesis essays are often parts of larger projects and are used to make reviews of particular aspects, for example, in medicine and social sciences. When composing this type of essay, you should provide full information about the examined object, state, or problem. The literature review should contain as many key points and peculiarities as possible. Thus, it will draw a complete picture of an aspect that will bring clarification and worth to your topic. To hook your reader from the very onset, you should articulate a good synthesis thesis statement in your introductory paragraph.

Common Topics Encountered in Synthesis Essays

To help you with a topic choice for your AP Lang synthesis essay, we listed some from different fields and sciences. The first of three essays is about AI technology. We tried to single out the most relevant example prompt topics for you to get started with. Check them out below.

  • Artificial intelligence: Big threat or valuable tool for modern society
  • Cryptomarket: The ups and downs
  • Technology in the traditional classroom: A threat or benefit?
  • Explain whether testing new drugs on animals is ethically permissible
  • Should alternative medications be covered by insurance?
  • Disturbance regimes under Global Warming
  • Explaining how the American way of life contributes to global warming
  • Distance education: Its effect on college students on campus
  • Can modern people keep complete control over their life?
  • Nuclear or solar power: Benefits and Demerits
  • Explain the impact of gas fuel plants
  • Remote work impact on people: How is their physical activity?
  • Explain the role of sport in the American education system
  • Is it possible to buy happiness for money?
  • The basic survival skills everyone should know

Tips on How to Write Synthesis Essay

It is easier said than done when it comes to writing a synthesis essay. That is true, and for this reason, we outlined the list of valuable synthesis essay tips we consider the most essential to focus on. They are helpful for both writing an AP lang synthesis essay and a term assessment. Check them out.

Conduct Thorough Research

A good paper is regarded as meaningful when it is based on deep and all-encompassing research. Don’t neglect to provide a thorough exploration of your topic. The more information you find, the more valuable and reasonable your essay will be. But make sure you use credible sources to summarize and synthesize the data. Once you have a viewpoint to reveal, look for sources that support it or oppose it so that you can use them to substantiate your perspective.

Look from Diverse Perspectives

When willing to express one particular point or argument, consider other perspectives that might contradict your ideas. Why is it important? You should be aware of all the main arguments or acceptances occurring around your topic. It is essential to study different points of view that emerged on the basis of your theme or aspect under study. This could help you disclose another side or significance of your essay topic and change the focus of the main content you want to unleash. Doing this can reveal a new perspective, idea, or aspect of your synthesis essay’s research.

Choose an Organizational Method

Although an essay has a standard structure, your content should be well-composed and introduced coherently. All data should be outlined so a reader will enjoy the smooth turn from one statement to another. Depending on the field and aspect you are preparing a synthesis essay about, there are three methods to organize the content in your paper. They are the following:

Chronological Method

If you include dates or other significant events in your review or argumentative essay, it makes sense to present them in chronological order. Every fact should be justified per its development. So later, you can introduce your perspective or statement that will explain the impact of prior events. For example, when revealing a particular historical period in the US, you should first mention all important events chronologically. So then, you can argue your idea about the changes they brought to the country from a political or international perspective.

Thematic Method

A synthesis paper can be written for any field of science to represent a shorter version of facts, viewpoints, research results, etc. That’s why students can come across some topics that require uncovering a few themes in one essay. It is where a thematic method of content organization takes place. You should determine what notions or terms should be mentioned and revealed in your paper. Then, think of what term might explain or continue a key message of another term. Once you find out this detail, you should present each term one after another, keeping coherence in the information flow.

Point-by-point Method

As synthesis papers deal with different ideas, arguments, viewpoints, etc., comparison as a research method has a place. You can operate with many hypotheses, approaches, ideas, and arguments, so comparing them and finding their similarities and differences makes sense. This content organization method involves explaining one point of the synthesis statement, and then another point to compare further.

Crafting a successful synthesis essay requires a well-structured outline, which can be challenging to develop without assistance. Luckily, many academic essay writing services, such as PapersOwl.com, offer support in this area. To help you get started, here is an outline you can utilize to write a compelling synthesis essay that will leave a lasting impression on your professor.

Make a Synthesis Essay Outline to Structure Content

Synthesis Essay Outline

Earlier, we emphasized the importance of orchestrating your main content under study. This section covers the crucial thing in writing a synthesis essay: an outline. The outline is a great synthesis essay template for structuring your entire paper. We recommend you always stick to it once you define your essay’s topic and objective. Thanks to it you will be able to keep your focus on the angle of your work.

If you want to deepen your knowledge, we have prepared steps on how to write a synthesis essay outline. The outline of your essay must include three main components, but it can vary, and mostly the main difference is in a short and cited presentation of the thoughts you want to reveal in your essay. Below, we introduce a brief outline structure:

  • Introductory part

The beginning of your essay mustn’t be too long. It is enough to disclose your objective, the main topic, and a strong thesis statement in one paragraph. It doesn’t make sense to keep a reader’s attention for long in the introduction, explaining what you are going to describe or argue in detail. Present it shortly and precisely.

  • Body paragraph

In this part of the essay, you should introduce all you have researched, analyzed, and systematized. Likewise, you should expose your material in a minimum of three paragraphs. Each part has an appropriate synthesis-paragraph structure. In the outline, we recommend you craft a bullet list of three here and note shortly what points you want to describe in each paragraph.

This is the summarizing part of the essay, where you conclude all the information introduced in your synthesis essay. It is essential to repeat the thesis statements here. It should also be concise.

Write an Engaging Introduction

A good synthesis essay should get a reader engaged straight from its introduction. An introductory part should be composed in an interesting way to keep reading your essay. Here is where a reader finds out about the background of the topic and what main problems or ideas will be discussed. Such information should be catchy, and it is essential to make the first opening sentence sharper.

Another important thing in the introduction is crafting a hooky synthesis essay thesis statement. The thesis will be like a compass to the main points of your essay. Try to make the topic sentence specific and intriguing by matching your essay objectives.

Introduction synthesis essay example: When it comes to running a successful business, there’s no doubt that having the right people on board is crucial. After all, a company is simply a group of individuals working together towards a common goal. However, not enough emphasis is placed on what the “right” people actually look like. That’s why I wanted to bring attention to an often overlooked but incredibly important attribute: resistance. In this article, I’ll explain what resistance is, why it matters, and how you can identify it in potential team members.

Critically Analyze Sources and Identify Their Relevance to the Thesis Statement

A thesis presents a key message of your paper. This is what both reveals the focus of an essay and captures a reader’s attention. That’s why it requires exploring many sources carefully and critically analyzing them to identify their relevance. So then, you can formulate a strong thesis statement that will combine the key points of the synthesis essay. The more valuable data you find and analyze, the more precious your thesis.

The Main Body

There are three parts to your essay, each using a different type of evidence. The first two sections should contain evidence that supports your thesis. This can be in the form of direct quotes from your sources , statistics, and/or other research that supports your claim. The third section should contain evidence against your thesis – or what some might call “counterpoints” or “arguments against”.

Building on this structure, it’s imperative to recognize that the very foundation of your thesis relies on the robustness of these supporting arguments. Let’s look closer.

Support Your Arguments

Every thought, idea, assumption, and definition from your thesis statement must be justified by supporting arguments. No one will get involved in a piece that tells about everything and nothing simultaneously when there is no evidence and proof of mentioned facts. This point is vital as your perspective must have a background, and you should explain the reasons you provide a particular argument or viewpoint.

Extensive research and analysis of credible sources allow students to come up with exciting and valuable solutions, ideas, and directions. That’s why the time spent on deep study will always pay you back. It is a very significant component in writing argumentative synthesis essays. So, make sure you find supporting arguments for the idea or perspective you want to convey to a reader. This will increase the persuasiveness and worthiness of your message in the essay.

Address Counterarguments

Sometimes, it is difficult to persuade someone when many counterarguments make your point of view unworthy. The same might happen when you decide to start a synthesis essay and prove your opposite perspective. This task is challenging and requires thorough research of counterarguments. Only by having analyzed a massive set of information, one can provide reasonable comparisons and meaningful explanations to let a reader take their perspectives into account. Here are a few helpful tips on how to maintain a persuasive stance while considering opposing viewpoints:

  • Study all counterarguments that might be according to your viewpoint;
  • Learn the background of the counterarguments;
  • Find out what consequences they can lead to (if they are negative);
  • Weigh the influence of opposing arguments and find their weak points;
  • Justify your viewpoints clearly and precisely with supporting evidence;
  • Provide comparative analysis to underline the significance of your perspective;
  • Never ignore the counterarguments in your informative synthesis essay paper.

Craft a Strong Conclusion

The conclusion is the last but not least component of a synthesis essay structure. The train of thoughts and ideas kept during the entire paper shouldn’t be interrupted instantly. It must have an excellent finalizing part where you sum up all mentioned in your essay and leave a good touch for your reader.

To craft a strong conclusion, you should present an overview of your research and note the main points of your argument or perspective. But remember, the conclusion doesn’t have to be too long and saturated. It should be brief, concise, and precise. Remember to remind your reader of your thesis statement and emphasize the relevance and significance of your essay’s topic.

Conclusion synthesis essay example: Through our research, we have identified effective strategies for dealing with repetitive motions in individuals with Autism Spectrum Disorder. It is clear that multiple behavior modification therapies are important for improving this behavior. Further exploration into behavior modification techniques could lead to finding more therapy techniques that can greatly improve the lives of those with repetitive motion behaviors. We believe that this research can make a significant impact in helping individuals with Autism Spectrum Disorder lead more fulfilling lives.

Bibliography

A bibliography is a list of books, journals, and other sources of information used in the essay. The bibliography should be alphabetically arranged by the author’s last name. All sources should be listed separately on a separate page following the main body of text or at the end of your paper.

Your research sources should be properly credited at the end of the essay, whether you’re using MLA, APA, or another format . The most common form for citing an author’s work is called “parenthetical citation” or “in-text citation.” In parenthetical citations, you include the title of the work (italicized), page numbers if applicable, year published (if applicable), medium (e.g., book), and publisher’s name (if not self-published).

Proofread and Edit Your Essay

Even if you think your work is impeccable, it needs to be proofread and edited. While you are concentrating on the writing process, you might skip some other nuances. This can be punctuation, typos, grammatical errors, or incorrect sentence order. For this reason, a synthesis essay must go through thorough proofreading to detect any kind of errors. Apart from this, you can split one body paragraph into two, for example, if you find different points discussed in it. You should also format it using a particular format style to handle a well-structured, edited, and formatted essay.

Bottom line

Wrapping up, we encourage you to follow our tips on how to write a good synthesis essay. Although any type of writing isn’t easy work, you can do it well with the help of good supporting sources available on our website. If you are short on time and understand that you can’t cope with this task, you can find an expert who writes essays for you to meet your deadlines. But if you decide to make it up alone, make sure to craft an outline and follow all the insightful tips mentioned in this article.

How long should a synthesis essay be?

How many paragraphs are in a synthesis essay, is a synthesis essay argumentative, does a synthesis essay have a counterargument, readers also enjoyed.

Synthesizing Sources: Key for Cohesive Writing

WHY WAIT? PLACE AN ORDER RIGHT NOW!

Just fill out the form, press the button, and have no worries!

We use cookies to give you the best experience possible. By continuing we’ll assume you board with our cookie policy.

what is the synthesis in an essay

what is the synthesis in an essay

Full Guide to Synthesis Essays: How to Write a Synthesis Essay

Nick Miller

Nick Miller

Today, people are dealing with numerous amounts of data. This means that an average person has to develop an important skill — analyzing information found online to determine its quality. Such a skill is developed naturally as a person grows. However, its importance becomes more apparent with technological progress, which comes with its own issues.

As a result, the ability to analyze and synthesize information became a crucial part of the academic curriculum. This is why students often write synthesis essays. These are some of the most common assignments that a student has to deal with, but that does not mean that everyone knows how to write them. In this blog post, I will provide you with information on what is a synthesis essay, how to write one, and tips to improve your writing skills. I hope that this information will help you out.

What is a Synthesis Essay?

A synthesis essay is a type of academic writing that focuses on combining information from several sources to create an argument or a perspective on a given topic. These essays differ from other types because they require writers to analyze different viewpoints to pick the main ideas and create a unified stance on a topic. That is why synthesis essays are challenging. Students have to demonstrate skills such as critical thinking, research, and information synthesis. A well-developed essay synthesizes information from different sources to create a piece of writing that offers readers a nuanced understanding of a topic.

Key Components of a Synthesis Essay

To understand how to write a synthesis essay, it is required to know what it consists of. Similarly to other types of academic writing, synthesis essays have their own components. I will explain the most important elements of such an essay below.

Thesis Statement

A well-developed thesis statement is the main point of a synthesis essay. It presents readers with what they are going to read about. A thesis statement is a guide that allows readers to understand the author’s main stance and how they are going to synthesize their ideas to prove it.

Sources Integration

A synthesis essay requires the writer to conduct thorough research. With access to books, journals, websites, data sets, etc., it is possible to gather all the required information. This information has to be integrated to support the thesis and provide readers with a comprehensive understanding of the topic.

Synthesis of Information

Gathered information has to be combined to form a cohesive thought or central idea. To do this, a writer needs to analyze and interpret information from sources. Interpretation of all the pieces gathered from sources is what makes a synthesis essay.

Counter Arguments and Refutations

Synthesis also means that the author has to acknowledge and address opposing arguments. The incorporation of counter arguments is a testament to the quality of one’s synthesis of information. Instead of presenting a one-sided argument, it is better to address counter points and refute them.

The conclusion restates the thesis statement and summarizes all the ideas explored in the essay. It also serves as a closure that underlines the importance of the information provided by the author. This section of an essay should leave a lasting impression and solidify the writer’s stance on the topic.

Tips and Tricks for Writing an Outstanding Synthesis Essay

Synthesis essays are specific and require a careful approach to them. Thankfully, there are universal tips and tricks that I actively use in my writing. They will help you to understand how to write a synthesis essay of top quality every time as well!

Choose a multi-faceted, debatable topic

It is better to choose a topic that allows you to approach it from different perspectives. A multi-angle subject gives ground for extensive research and incorporation of various materials for a future synthesis essay.

Research credible sources with diverse perspectives

The quality of sources matters in academic writing. That is why you should investigate reliable sources to gather information for your topic. Credible sources include journal articles, reputable books, data sets, etc.

Take clear, organized notes tracking differences

Remember to take notes when performing research. I use notes to structure my thoughts and not get lost. You will encounter different information and perspectives, requiring you to sort them according to common and different points of view. This way, you will be able to spot these specific points and ease your essay-writing process.

Develop an insightful, focused thesis

To create a coherent thesis statement, you want to state your main argument while reflecting on the synthesis of perspectives that you describe in the essay. A well-crafted thesis statement will guide readers when addressing the topic you are writing about.

Use rhetorical techniques

The use of rhetorical techniques such as ethos, pathos, and logos is important for increasing persuasive power of a synthesis essay. They will appeal to your audience’s emotions, logic, and credibility.

How to Write a Synthesis Essay?

Step 1: choosing a compelling topic.

The first step in writing a synthesis essay is to select a topic that you find particularly interesting. However, this topic should also provide ground for exploration. I always opt for areas that interest me the most for additional motivation. With a properly selected topic, you can go deep into research to find different points of view. A topic that creates space for discussion and analysis is the best way to engage readers. Therefore, a proper choice of a topic will allow you to present the topic in a nuanced manner that provides value for the target audience.

Step 2: Conducting thorough research

Any strong synthesis essay requires thorough research. To begin with, I suggest starting by selecting a range of sources that you will base your research on. This could include academic journals, scholarly articles, reputable books, etc. After selecting sources, take notes to track the points discussed in each piece of research. This way, you will be able to track differences and similarities between sources. Such an approach will allow you to build a base addressing potential counter points and create a well-informed synthesis essay.

Step 3: Crafting a strong thesis statement

A strong thesis statement has to capture the main idea of your synthesis essay. It should include a synthesis of information that you gathered during research. This way, you will provide readers with a one-sentence summary of what they can expect from your writing. A thesis statement should be clear, specific, and coherent. Clarity plays an important role in delivering your main idea to readers while hooking them to continue reading through the essay.

Step 4: Evaluating and selecting relevant sources

Evaluate your sources to ensure the reliability and validity of information that you put into an essay. This process is crucial as the use of high-quality and recent sources strengthens main ideas of your synthesis essay. To do so, you should consider several factors such as author’s credibility, publication date, publication source, citations and references, and potential bias. With these factors checked, you will select the most appropriate sources for your synthesis essay.

Step 5: Structuring the essay (Introduction, Body, Conclusion)

Synthesis essays follow a traditional essay structure that is common in academic writing. The introduction should provide readers with context of the topic and a thesis statement to highlight key points that are discussed in the essay. Each body paragraph has to address a particular point to maintain clarity and ease of flow. Conclusion should restate the thesis statement, summarize synthesis, and reinforce your thesis. Combination of these structural elements ensures readability and comprehension of the essay.

Step 6: Incorporating evidence and examples

Integration of evidence from previously selected sources supports your thesis statement and arguments. You want to show how each piece of information contributes to the central idea of your synthesis essay. Incorporation of evidence and examples is central to highlighting your original ideas and distinguishing them from the ones taken from sources. This way, you will considerably improve the credibility of your thoughts and showcase the variety of sources that you synthesize to explore a topic.

Step 7: Analyzing and synthesizing information effectively

A strong synthesis essay example effectively combines diverse perspectives into a unified narrative. This means that synthesis requires writers to focus on exploration of relationships between sources. You can differentiate patterns, ideas, and connections between sources you gathered. Such an approach will allow you to show a nuanced understanding of a topic. A deep synthesis goes beyond compilation of information from different sources. It presents readers with a sophisticated argument that brings value to them.

Synthesis Essay Example Analysis

This synthesis essay example focuses on the ethical implications of using animals for testing drugs. It examines arguments in favor of animal testing while emphasizing the role of practice in advancing medical research. In contrast, the essay assesses ethical concerns that arise from animal testing such as test subjects’ welfare, suffering, and relevance of outcomes to humans.

A synthesis of information from scientific studies and ethical frameworks creates a balanced perspective of two different perspectives. A contrast of scientific arguments and ethical considerations creates ground for finding potential alternative solutions for the problem. Each paragraph addresses separate points mentioned in the thesis statement. The conclusion restates the thesis statement and summarizes ideas explored in the body paragraphs.

I tried to cover all the information regarding synthesis writing including what is a synthesis essay, its key components, and tips to create a compelling synthesis piece. A combination of reliable sources, synthesis of points into a coherent narrative, and a balance of arguments and counter arguments results in high-quality synthesis essays. However, remember that everything has to be logical and structured. You need to ensure that your synthesis writing is easy to read and understand. Writing a synthesis essay is not an easy task. That is why you can consider using AI tools, such as Textero AI-powered essay generator , to assist you in creating a compelling essay.

What is a synthesis essay?

A synthesis essay combines information from sources to create an argument on a topic. It is characterized by critical analysis of information, integration of different points of view, and their consideration from multiple perspectives.

Why are synthesis essays useful?

Synthesis essays promote critical thinking. They require students to use their research and analytical skills to present different perspectives in a compelling manner. The ability to address arguments and counter arguments naturally develops students’ critical thinking capabilities.

How do I pick a good synthesis essay topic?

A good synthesis essay topic is relevant and multifaceted. A topic should provide ground for debates and exploration of different perspectives. This means that students should choose topics that serve as a platform for discussion, in-depth analysis, and synthesis.

What types of sources should I use?

Synthesis essays require reliable sources to create a solid foundation for research. That is why it is advisable to focus attention on academic journals, books, and reputable web pages (news outlets, etc.).

How many sources do I need?

The number of sources required for a synthesis essay is not fixed. It can vary and depend on the perspectives covered in each source. Ensure that the number of sources that you use fully covers points that you want to explore in an essay.

Should I summarize or analyze my sources?

It is better to summarize sources to convey their key points. However, analysis is also important to fully understand sources’ main ideas and connections. Combination of summaries and analyses allows you to fully explore a topic.

What should my conclusion include?

A conclusion should restate the thesis statement, summarize synthesis points, and emphasize the importance of the topic. These elements should be combined to leave a lasting impression on readers.

Nick Miller

Written by Nick Miller

AI enthusiast, student, and just life lover

Text to speech

Logo for Pressbooks @ Howard Community College

Want to create or adapt books like this? Learn more about how Pressbooks supports open publishing practices.

27 How do I Write a Synthesis Essay?

A synthesis essay is a type of essay that gathers information from a variety of sources to form a new idea, question, or argumentative thesis. Writers composing a synthesis essay will discuss ideas, data, and evidence from a series of sources to either explain or argue something original.

Explanatory vs. Argumentative Synthesis Essays: How Are They Different?

Though the formatting is largely the same, there are two main types of synthesis essays: explanatory and argumentative.

  • 1.   Explanatory : The purpose of an explanatory synthesis essay is to use different sources to explain a particular point of view. These synthesis papers objectively examine the similarities and differences between ideas but don’t necessarily choose a side or attempt to sway the reader in any direction.
  • 2.   Argumentative : An argumentative synthesis essay follows the same structure as a typical argumentative essay. The thesis of an argumentative essay will argue one specific point.

Synthesis Essay Structure

Synthesis essays typically adhere to the five-paragraph essay structure, but there are slight nuances to structuring this type of essay. Here is how a synthesis essay is structured.

  •   Introduction : The foundational ideas of your essay are expressed in the introductory paragraph. You will address the general landscape of ideas around your topic, introducing some of your sources. You will also introduce the argument to be made through a thesis statement, which succinctly states your primary argument in a sentence or two. The thesis statement typically comes at the very end of your introductory paragraph.
  •   Body : The body of your synthesis essay is usually about three paragraphs long. This typically includes two paragraphs synthesizing your sources in a way that supports your argument, and one paragraph that acknowledges opposing arguments.
  • Conclusion : The conclusion of your synthesis essay reiterates the argument that you’ve made throughout your essay. It may emphasize how each of the points you made and the sources you’ve cited substantiate your point.

How to Write a Synthesis Essay

A great synthesis essay walks readers through a series of ideas and sources to prove or explain a larger point.

Follow this step-by-step guide for writing your essay:

  • Choose a topic you’re curious about . Brainstorm a few ideas for your synthesis essay topic, prioritizing the subjects you feel passionate about.
  • Do your research . Once you’ve decided on a topic, use the internet, library, and other sources to perform extensive research. You can turn to academic primary sources to find quotes from scholars and experts, or look up statistics or scientific studies relevant to your topic. This research will help you develop a point of view that is backed up by concrete information. Use credible sources that are unbiased.
  • Outline your point . Your entire essay should focus on either explaining a certain perspective or making an argument. Outline how each of your sources relates to your theme and support your idea.
  • Write your introduction . An introduction is the first paragraph of a paper. Its main purpose is to present the general premise of the paper, provide any necessary background information, and hopefully, capture the reader’s attention. The introductory paragraph to your synthesis essay should be where you include a strong thesis statement. This is where you will state the point of view that you’re exploring or the argument you’re making.
  • Include your body paragraphs . Synthesis essays will typically contain three body paragraphs. A good body paragraph contains three main sections: a topic sentence (or key sentence), relevant supporting  sentences, and a closing (or transition)
  • sentence. This structure keeps your paragraph focused on the main idea, providing clear, concise information. Each body paragraph should discuss different elements and supporting arguments of your thesis, along with evidence drawn from each source. Explain the common theme between your resources, as well as how they are relevant to your text. Include counterarguments as well as how your source material can discredit those claims and support your own idea.
  • Wrap it up with a strong conclusion . A conclusion is a final piece of writing in a research paper, essay, or article that summarizes the entire work. The concluding paragraph of your synthesis essay will restate your thesis, summarize the key supporting ideas you discussed throughout the work, and offer your final impression of the central idea.
  • Proofread . Always proofread your writing a few times before submitting or presenting it. A few missed words or grammatical errors can sometimes change or discredit the entire crux of an argument or opinion. Make sure that your grammar, syntax, and flow are as accurate and clear as possible. This will help you come across as a credible source.

College Reading & Writing: A Handbook for ENGL- 090/095 Students Copyright © by Yvonne Kane; Krista O'Brien; and Angela Wood. All Rights Reserved.

Share This Book

How to Write a Synthesis Essay: Examples, Topics, & Outline

A synthesis essay requires you to work with multiple sources. You combine the information gathered from them to present a well-rounded argument on a topic. Are you looking for the ultimate guide on synthesis essay writing? You’ve come to the right place!

In this guide by our custom writing team, you will find:

  • a step-by-step writing guide;
  • a list of 34 synthesis essay topics;
  • a full essay sample in MLA format.
  • 📚 Synthesis Essay Definition
  • 📝 Essay Types
  • ✅ Step-by-Step Guide
  • ✍️ Topics & Prompts
  • 📑 Example & Formatting Tips

📚 What Is a Synthesis Essay?

A synthesis essay is an assignment that requires a unique interpretation of a particular topic using several reliable sources. To write it, you need to understand, analyze, and synthesize information. That is why this type of essay is used in the AP Lang exam to assess students’ reasoning skills.

The key features of the synthesis essay are:

  • Debatable topic . If your goal is to write a good synthesis essay, it’s necessary to choose an arguable topic. It’s best to choose something that people have different opinions about. This will allow you to use many sources with various viewpoints for your synthesis.
  • Clear thesis statement. It’s a sentence that briefly describes the main idea of your essay.
  • Reliable sources to prove your thesis . For a synthesis essay, your opinion is not enough. You also need to find the evidence. Keep in mind that simply reading an online encyclopedia won’t do; make sure to choose only reliable sources.

What Does It Mean to Synthesize Information?

Synthesis is a process that has huge importance in nature, science, and our everyday life. The word stems from Ancient Greek “synthesis,” which means “putting together.” In general, synthesis is the combination of components to form a connected whole.

The picture shows examples of synthesis usage in various spheres: biochemistry, physics, and sound creation.

In everyday life, we usually resort to it to synthesize information . This means taking the data from different sources and bringing it together. This process is the opposite of analyzing:

  • For an analysis , you break problems into pieces,
  • For a synthesis , you combine separate elements into a whole.

We use synthesis for analysis papers, research papers, argument papers, and business reports.

What Does Synthesis Mean in Writing?

Synthesis in writing means summarizing and connecting different sources considering a particular topic. Although synthesis and analysis are two opposite things, they usually go together in synthesis essays. The process consists of 2 stages:

  • Conduct the analysis. For that, you break down a problem into parts and analyze the sources. It’s helpful to highlight everything regarding your topic while reading.
  • Carry out the synthesis. The next step is to formulate an opinion and combine the highlighted information from the sources.

Synthesis is not only used in writing but also in reading comprehension . It’s useful to do this kind of reading while studying your sources. There are three reading comprehension stages:

  • Your previous knowledge about the topic.
  • Expansion of your knowledge while you are reading.
  • Understanding of the problem when you have finished reading.

So, synthesized reading comprehension means combining three stages in one and formulating one statement.

Synthesis vs Summary: What Is the Difference?

A summary is a paraphrasing of the written source in your own words. For a good summary, it’s necessary to include all of the text’s key elements. Meanwhile, synthesis means combining different ideas from different sources. You don’t have to include all the key points; just choose everything related to your topic.

The picture explains the difference between a synthesis and a summary.

Both of these techniques are used for the synthesis essay:

  • The summary goes in the conclusion. You briefly sum up your paper’s main ideas.
  • Synthesis goes in the body paragraphs. Here, you combine multiple sources to prove a point.

📝 Synthesis Essay Types

There are two main types of a synthesis essay: argument and explanatory synthesis.

Both of them require working with multiple reliable sources and analyzing information. The only difference is that an argument synthesis essay requires your own opinion, while an explanatory synthesis essay does not.

Argument Synthesis Essay: Outline and Definition

As you already know, an argument synthesis essay requires you to state your own opinion about the given topic and back it up with several reliable sources. The purpose of such an essay is to persuade the reader that your point is correct.

Here’s what an argument synthesis essay consists of:

Explanatory Synthesis Essay: Definition and How to Write

An explanatory informative synthesis essay requires you to stay neutral towards the problem you are discussing. This means you cannot express your own opinion considering the given question or a problem. Your task is just to inform the reader. That’s why this essay type is also called informative synthesis.

Check out this explanatory essay outline:

✅ How to Write a Synthesis Essay Step by Step

When it comes to the synthesis essay outline, it’s not too different from other assignments. Have a look at this template:

The picture shows a synthesis essay outline: introduction, main body, and conclusion.

How to Synthesize: Working with Sources

After you’ve decided on your topic, it’s time to figure out how to synthesize articles into one text. This is how you do it:

  • Choose reliable sources: the ones printed in journals or published on academic websites.
  • Become familiar with them and see if they fit into your essay.
  • Try to find a few sources for each point. It will increase your essay’s reliability.
  • Relate each source to your arguments and see similarities between them.
  • Don’t forget to list every source in the references.

When you are done with a comprehensive analysis of related literature, try to step back and imagine a person who has a different opinion on this topic. Think of some arguments that they can provide to prove their opinion. After you have the list of arguments, find the written evidence of why they are wrong and put them in your essay.

Analyzing and organizing sources is the first and very important step for the synthesis essay. So make sure you do understand what the text means before using it as a reference.

Synthesis Essay Outline: How to Write

For structuring your essay, it’s useful to try mapping . This technique means combining the information from different sources and rearranging it to create a new direction. To do it, you need to analyze the authors’ ideas and come up with your own conclusions.

The best way to do that is called synthesis matrix or graphic organizer. It’s a chart that you can make when you start working on your essay. Here you have a horizontal column that states the main ideas and a few vertical columns that present sources. Your task is to take sources you have chosen and write down the main ideas from them.

Here’s an example of a matrix chart:

Topic: The influence of technologies on teenagers

While doing that, you will see how many sources contain the same ideas. When you analyze them, you will be able to formulate your thesis backed up with evidence. The synthesis matrix also helps to see new arguments you can cover in your synthesis paper.

How to Write an Introduction for a Synthesis Essay

Now it’s time to start writing the paper. In the introductory part of the essay, you can include:

  • A short yet catchy sentence or a quotation that would present the topic. The start of your essay should make people interested. It’s best to make the first sentence not only informative but also easy to understand.
  • The texts that are used for the essay. Provide the titles and the authors’ names (use the appropriate guidelines depending on the writing style.)
  • The background information which is needed to understand your essay. Definitions of terms or unknown words considering the topic can be included in this part. Otherwise, people may find it hard to understand what they are reading about.

How to Write a Thesis for a Synthesis Essay

A thesis statement is a point of view on a certain problem that you will defend in your essay. It should contain the key points that you want to include in your paper. Here’s how to create a perfect thesis statement:

  • Find several central ideas in the chart.
  • Choose the ones that are repeated the most often and the ones that you feel need to be in your essay.
  • Combine them, and you have a thesis statement with all the key points.
  • Make a draft of the thesis statement. Try to formulate the main idea you want to present in your essay.
  • Elaborate on this idea. Add some details and expand it a bit further.

If the whole picture is coherent, and it conveys exactly what you wanted, then this is your perfect thesis statement. See the example below:

Gender inequality still exists at the workplace: women are less likely to get the most responsible positions, easily lose careers due to maternity leave, and often receive less pay for the same amount of work.

How to Write Synthesis Paragraphs for the Main Body

Your essay’s main body consists of a few paragraphs. Each of them presents a different argument considering the topic. When you start a paragraph, make sure to begin with a topic sentence, which informs the reader about the paragraph’s main idea. Then, include the synthesized sources and elaborate on them.

Here’s what you should and shouldn’t do when writing the main body:

✔️ Dos❌ Don’ts
Make sure you make the essay as informative as possible. Try to show various opinions of the authors. Avoid shuffling unrelated information into it. Try to make smooth transitions from one paragraph to another. Instead, show your understanding and present the conclusions you’ve drawn from the texts. If you do that, you are involved in plagiarism. This would damage your credibility.

You can use the following words to present the ideas from your sources. They will help you reflect the authors’ tone:

Talking about argumentsTalking about researchAdding emphasis
The author: The author: The author:

How to Conclude a Synthesis Essay

There are quite a few ways to conclude the synthesis paper. Have a look at some of the options:

  • Paraphrase the thesis. As you remember, the thesis is the main idea of your essay. The conclusion is a good place to remind your readers about it. When they are done with the reading, they remember the most important thing from your essay.
  • Synthesize the arguments. There is no need to repeat everything you wrote in your essay. Just briefly summarize the most crucial points.
  • Answer the “So what” question. Tell the readers why this topic matters, why you’ve chosen it, and why it’s valuable for the reader.
  • Provide a closure. It’s an effective strategy when you want to make the reader think. Leave them with a strong statement at the end of your essay.

Synthesis Paper Proofreading Tips

When you have finally written your paper, there is still one important thing left to do. You need to check your paper for any grammatical and contextual mistakes. You certainly can do it yourself, but it would be perfect if you could ask somebody else to read it.

The first thing you need to check grammar-wise is the tense you are using. There is no single tense you need to use for the synthesis essay. It depends on the format:

  • If you’re writing in MLA format, use the present tense;
  • For APA essays, you use the past tense.

The next step is to check whether your synthesis essay has everything that’s required. For that, we have prepared the checklist of questions you can ask yourself to proofread your essays.

  • Is there a clear thesis statement?
  • Did you include all of the key points from the synthesis?
  • Are there clear transitions between paragraphs?
  • Did you organize a paragraph around a single idea?
  • Did you use reliable and up-to-date sources?
  • Did you analyze sources rather than just summarize them?
  • Did you mention every source you’ve used?

If you’ve answered “yes” to all the questions—congratulations, you are done with the essay! Otherwise, you need to come back and fix everything that you’ve answered “no” to.

✍️ Synthesis Essay Topics and Prompts

Sometimes, when you don’t have a topic , it is tough to come up with a suitable idea. That is why we have prepared two lists of topics that you can use for any synthesis essay type.

Explanatory Synthesis Essay Topics

The topics below are suitable for an explanatory synthesis essay:

  • The beginning of Hollywood cinema. Cinema is a huge industry in the USA. Tell the readers about its history. Describe what it was like in the beginning, which movie was the first one, and who started this industry.
  • Tactics on dealing with noisy children. Sometimes kids can be very loud, especially in public places. Write about different tactics that can help with this issue.
  • The effects of climate change on the water cycle.  Climate change has affected the water cycle significantly. Your task is to explain how.
  • The best American cities to live in. Provide the list of the best cities and explain why you’ve included them.
  • The importance of a healthy diet . Keeping a healthy diet is beneficial in many ways. Write about all the advantages it brings.
  • Who can become an entrepreneur? Entrepreneurship is not for everybody. In this essay, you can describe the qualities needed for having your own business.
  • The correlation between overpopulation and poverty . Describe how overpopulation leads to poverty and vice versa.
  • The advantages of taking an active vacation.
  • Cultural shock as a part of moving to a different country.
  • The consequences of the first wave of feminism.
  • Synthesis of Tan and Rodriguez’ essays ideas. 
  • Difficulties you may encounter during the job interview.
  • How does reading prevent Alzheimer’s disease?
  • The effect of the COVID-19 pandemic on businesses.
  • The connection between religion and politics in ruling the country.
  • What can non-verbal signals tell you about a person?
  • The psychology of leadership .
  • The origins of the most common  stereotypes  about Americans.
  • Role of social media in business communication.
  • The synthesis of personal nursing philosophy concept. 
  • Behavioral components of schizophrenia and psychosis.
  • Main components of successful entrepreneurship.
  • Critical components of scientific research.
  • Change in religion and human beliefs throughout history.
  • The effect of global warming on modern life.

Argument Synthesis Paper Topics

The list of topics for the Argument Synthesis Essay:

  • Vaping is better than smoking. People are starting to exchange cigarettes for vapes and e-cigarettes. In what ways are they less harmful?
  • Rich people should pay higher taxes. The same percentage of money doesn’t equal for rich and poor people. Explain why the ones who can afford more should share with others.
  • Depression is a disease. Prove that psychological problems must be recognized as real health issues that should be cured and not ignored.
  • Social media affects young people’s lives. Social media has a massive influence on people. In this essay, you can discuss which life spheres are the most affected.
  • Beauty pageants should be banned. Provide the reasons why they should be banned and tell the reader about psychological problems they can cause.
  • People should cut meat from their diet to stop global warming. Describe how the meat industry influences climate change.
  • The voting age should be 25+. Your task is to show the reasons why the votes of people under 25 should not be taken into account during elections.
  • A healthy lifestyle requires a lot of money.
  • Each healthy man should serve in the military.
  • School bullying should be punished by immediate exclusion.
  • Does friendship exist between men and women?
  • Drinking coffee is a bad habit.
  • Working hard is more important than being talented.
  • Everybody should visit a therapist at least once.
  • Should universities be free?
  • Artificial intelligence will cause huge unemployment rates.
  • Gaming should not be allowed to children under 18.
  • Components and strategies of social responsibility
  • Integration of relevant ethical theory and conceptual principles in health care 
  • Children under 10 should be banned from gadgets.  
  • Social media platforms facilitate cyberbullying.
  • Issues of distance education.
  • Social media addiction is a serious disease.
  • Deforestation critically contributes to global warming.
  • Healthcare should be free for everyone.

📑 Synthesis Essay Example & Synthesis Essay Format Tips

Now let’s talk about formatting. There are two writing styles you can use for a synthesis essay: APA or MLA. You need to choose the one that is required for your assignment.

We will start with the paper in APA format. It is usually used in science and education.

Format
Title page
In-text citations Example: The artworks from the past are entirely different from the modern ones (Benjamin, 1935) Example: According to Benjamin (1935), “Mechanical reproduction of a work of art…” (p.7)
References Example: Benjamin, W. (1935). The Work of Art in the Age of Mechanical Reproduction. Random House

And these are MLA formatting rules:

Format
Title page
In-text citations Example: The artworks from the past are entirely different from the modern ones (Benjamin 7)
References Example: Benjamin, Walter. Random House, 1935

Finally, we’ve prepared a synthesis essay sample for you to check out. Feel free to download the PDF file below:

First introduced in the Civil Rights Act of 1964, affirmative action policies aim to mitigate the discrepancy in opportunities available for underrepresented social groups by taking into account one’s minority background. The policies have become a pressing public issue that obstructs previously marginalized individuals, particularly in the educational environment.

Thank you for reading the ultimate guide on synthesis essay writing. We hope you found it helpful. Don’t forget to share it with your friends. Good luck with your assignments!

🔍 References

  • Writing a Synthesis Essay: Bowling Green State University
  • What Is Synthesis: University of Manitoba
  • Synthesis: Biology Online
  • Reading Strategies: Difference Summarizing and Synthesizing: WordPress
  • Summary, Analysis, Synthesis Definitions: University of Utah
  • Argumentative Synthesis: University of Arkansas
  • How to Synthesize Written Information: Simply Psychology
  • Mapping of Synthesis Essay: University of Nevada, Reno
  • Writing a Literature Review and Using a Synthesis Matrix: Florida International University
  • Synthesis Essay: Cleveland State University
  • Literature Review: Synthesizing Multiple Sources: Louisiana State University
  • Writing a Conclusion: Texas Women’s University
  • General APA Guidelines: Purdue University
  • Share to Facebook
  • Share to LinkedIn
  • Share to email

How to Write a Catchy Hook: Examples & Techniques

Do you know how to make your essay stand out? One of the easiest ways is to start your introduction with a catchy hook. A hook is a phrase or a sentence that helps to grab the reader’s attention. After reading this article by Custom-Writing.org, you will be able to...

How to Write a Critical Analysis Essay: Examples & Guide

A critical analysis essay is an academic paper that requires a thorough examination of theoretical concepts and ideas. It includes a comparison of facts, differentiation between evidence and argument, and identification of biases. Crafting a good paper can be a daunting experience, but it will be much easier if you...

How to Write a Critical Thinking Essay: Examples & Outline

Critical thinking is the process of evaluating and analyzing information. People who use it in everyday life are open to different opinions. They rely on reason and logic when making conclusions about certain issues. A critical thinking essay shows how your thoughts change as you research your topic. This type...

How to Write a Process Analysis Essay: Examples & Outline

Process analysis is an explanation of how something works or happens. Want to know more? Read the following article prepared by our custom writing specialists and learn about: So, let’s start digging deeper into this topic! ♻️ What Is Process Analysis? A process analysis describes and explains the succession of...

How to Write a Visual Analysis Essay: Examples & Template

A visual analysis essay is an academic paper type that history and art students often deal with. It consists of a detailed description of an image or object. It can also include an interpretation or an argument that is supported by visual evidence. In this article, our custom writing experts...

How to Write a Reflection Paper: Example & Tips

Want to know how to write a reflection paper for college or school? To do that, you need to connect your personal experiences with theoretical knowledge. Usually, students are asked to reflect on a documentary, a text, or their experience. Sometimes one needs to write a paper about a lesson...

How to Write a Character Analysis Essay: Examples & Outline

A character analysis is an examination of the personalities and actions of protagonists and antagonists that make up a story. It discusses their role in the story, evaluates their traits, and looks at their conflicts and experiences. You might need to write this assignment in school or college. Like any...

Critical Writing: Examples & Brilliant Tips [2024]

Any critique is nothing more than critical analysis, and the word “analysis” does not have a negative meaning. Critical writing relies on objective evaluations of or a response to an author’s creation. As such, they can be either positive or negative, as the work deserves. To write a critique, you...

How to Write a Rhetorical Analysis Essay: Outline, Steps, & Examples

If you are assigned to write a rhetorical analysis essay, you have one significant advantage. You can choose a text from an almost infinite number of resources. The most important thing is that you analyze the statement addressed to an audience. The task of a rhetorical analysis essay is to...

How to Analyze a Poem in an Essay

Any literary analysis is a challenging task since literature includes many elements that can be interpreted differently. However, a stylistic analysis of all the figurative language the poets use may seem even harder. You may never realize what the author actually meant and how to comment on it! While analyzing...

Book Review Format, Outline, & Example

As a student, you may be asked to write a book review. Unlike an argumentative essay, a book review is an opportunity to convey the central theme of a story while offering a new perspective on the author’s ideas. Knowing how to create a well-organized and coherent review, however, is...

Argumentative vs. Persuasive Essays: What’s the Difference?

The difference between an argumentative and persuasive essay isn’t always clear. If you’re struggling with either style for your next assignment, don’t worry. The following will clarify everything you need to know so you can write with confidence. First, we define the primary objectives of argumentative vs. persuasive writing. We...

Main Chegg Logo

How to write a good AP synthesis essay

Published September 27, 2020. Updated June 7, 2022.

Synthesis Essay Definition

A synthesis essay uses information from multiple sources to support an argument or explanation.

Overview of Synthesis Essay Writing

First, take some time to develop a thorough understanding of what you will be writing about. Take notes as you go, keeping track of points you want to make and evidence you want to include in the essay. While you read, you can begin to brainstorm a thesis statement and outline for the essay. Writing an outline will help structure your essay and keep you on track. The standard synthesis essay outline includes an introduction, body, and conclusion. Spend adequate time reviewing the instructions, sources, and prompts.

The AP English Language and Composition (also known as AP Lang) exam is composed of two sections: a Multiple Choice section and a Free Response section. It’s normal to be nervous before an exam, especially an AP exam. If you’re not sure what to expect from the AP Lang synthesis essay, never fear. Here you can read about everything you need to know before exam day, including:

  • the purpose of the synthesis essay
  • what to expect from the sources and prompt
  • a sample prompt and response
  • how the synthesis essay is scored
  • how to write a high-scoring synthesis essay

Worried about your writing? Submit your paper for a Chegg Writing essay check , or for an Expert Check proofreading . Both can help you find and fix potential writing issues.

Synthesis essay

The College Board describes the synthesis essay this way:

“After reading 6–7 texts about a topic (including visual and quantitative sources), students will compose an argument that combines and cites at least 3 of the sources to support their thesis.”

You will have 45 minutes to complete the synthesis essay. How you use this time is up to you, but below we’ve included a timeline for how you might choose to use your 45 minutes.

What will the sources and prompt be like?

The six to seven sources will all be centered on a specific topic. In past exams, the prompt has been focused on subjects like alternative energy and eminent domain. At least two of the sources will be visual, and at least one will be numerical (a chart or graph). The others will be text passages of roughly 500 words.

Before the sources, you’ll be given directions and a writing prompt. The prompt will explain the topic, then present a claim for you to respond to. Your response should synthesize material from at least three of the sources, forming a full-fledged essay.

See a sample synthesis essay prompt directly from the College Board linked here.

Following the directions in this sample prompt, you’ll find Sources A-F. Click here to view sample student responses.

How will my synthesis essay be scored?

Synthesis essays will be scored on a range from 0 to 6 based on an analytic rubric. This score will be the total of three scores based on three categories: your thesis, your evidence and commentary, and your sophistication.

Click here to review the complete free-response scoring guidelines for the 2020 AP Lang exam. As a quick summary, we’ll provide the College Board’s descriptions for what warrants the highest and lowest points in each category.

According to the AP English Language Scoring Rubrics, 0 points in the thesis category will be given “for any of the following”:

  • There is no defensible thesis.
  • The intended thesis only restates the prompt.
  • The intended thesis provides a summary of the issue with no apparent or coherent claim.
  • There is a thesis, but it does not respond to the prompt.

1 point in the thesis category will be given to essays that respond “to the prompt with a thesis that presents a defensible position.”

0 points will be given in the evidence and commentary section to any essay that “Simply restates thesis (if present), repeats provided information, or references fewer than two of the provided sources.”

4 points will be given in the evidence and commentary section to an essay that “Provides specific evidence from at least three of the provided sources to support all claims in a line of reasoning” and “Consistently explains how the evidence supports a line of reasoning.”

Finally, in the sophistication category , 1 point will be given to an essay that demonstrates “sophistication of thought and/or develops a complex understanding of the rhetorical situation.” 0 points will be given to essays that do not meet that criteria.

While it’s natural to worry about your score, keep in mind that your scorers know you have less than an hour to complete your synthesis essay. They know it is essentially a first draft, and they will pay more mind to what you do right than what you do wrong. Even the highest-scoring essays will contain occasional errors, so worry less about perfection than your holistic argument and synthesis.

How to write a high-scoring synthesis essay

Before we dive into what makes a high-scoring synthesis essay, let’s cover the basics. What is a synthesis essay?

Basically, a synthesis essay uses information from multiple sources to support an argument or explanation. However, when it comes to the AP Lang exam, you will be writing an argumentative synthesis essay.

You’ll take an argumentative stance, which you will express via your thesis statement, and argue in favor of that stance using evidence from multiple sources.

Outstanding AP Lang synthesis essays tend to do the following things very well. They:

  • demonstrate an understanding of the topic at hand.
  • express understanding of the topic’s importance.
  • make the writer’s opinion on the topic clear early on.
  • frequently cite examples from the sources, such as statistics and quotes.
  • conclude with a strong “so what” point.

To write an essay that succeeds in all of these areas, you should use a few strategies on exam day.

Read, read, and read again

One of the worst mistakes you can make is to jump into outlining and writing before you’ve read and analyzed the directions, prompt, and sources. Though you have limited time, it’s worth taking some time to develop a thorough understanding about what you’ll be writing about.

Take notes as you go, keeping track of points you want to make and evidence you want to include in your essay. While you read, you can begin to brainstorm a thesis statement and outline for your essay.

Follow an outline

Even if you’re more of a “fly by the seat of your pants” type, an outline will help structure your essay and keep you on track.

Below is a standard synthesis essay outline to keep in mind. However, this is only an example, and your argument may not fit this outline exactly.

  • Give a bit of context on the subject, demonstrating the knowledge you gained from reviewing the sources.
  • Give a clear and concise thesis statement that presents your argument.
  • Topic sentence
  • Evidence #1
  • Evidence #2
  • Sum up the main points made in the essay.
  • Restate the thesis statement
  • End on a “so what?” statement.

Don’t lose track of time

While it’s vital you spend adequate time reviewing the instructions, sources, and prompt, it’s a lost cause if you don’t leave yourself enough time to outline and write!

Here’s a handy timeline to keep in mind during the 55-minute-long synthesis essay portion of the AP Lang exam:

  • Reading the directions, sources, and prompt: 15 minutes
  • Analyzing the sources and outlining your response: 10 minutes
  • Drafting your response: 25 minutes
  • Reviewing and revising your response: 5 minutes

Before you turn in that paper, don’t forget to cite your sources in APA format , MLA format , or a style of your choice.

Sample synthesis essay

Although you cannot know what your prompt and sources will be before exam day, you can prepare beforehand by reading sample synthesis essays  and writing practice essays from past questions .

AP synthesis example essay

Based on the 2020 prompt : 

The impact of television on political matters has been  under  debate for years. Television provides a low-cost method to  stay informed  about policy changes  and receive  important announcements, and  it  often  offers  a path to learn more about political figures and their plans for the United States. However, critics of television believe that there is a strong psychological and marketing strategy in play,  which  presents  false images of personalities and  is  commonly used as a tool to sway public opinion. While there are drawbacks to  broadcasting debates and politics ,  it  positively influences presidential elections by providing accessible information to viewers ,  shar ing  the candidate s’  personali ties , plans, and ideals during  their  potential role as president,  and  ultimately assisting citizens in casting their vot e.  

The  primary benefit of televising politics is t hat it provides  accessible information . Television, as s ource A explains , provides an opportunity for citizens to be more involved in political matters than ever before, specifically  by adding to  their  knowledge. With public speeches and political events televised, viewers can learn about the structure of the U.S. political system and build a better understanding  of  how legislation is created, in addition to their representative s’  contribution s  to political matters.  The reach of television is clear, as shown in Source D, where millions of viewers tune in every four years for the presidential debates.  T he data reports  that  80.6 million people view ed  the debates in 1980,  and even  in 1996, the chart’s lowest year of ratings, 46.1 million viewers tuned in — all who may have been influenced to vote !  The data shows that television is unmatched in  its  ability to reach voters , proving that it is a beneficial tool for providing information  to help  citizens  make their choices .  

Television also works as a trust-building tool between the viewer and the presidential candidate s . Although the criticism from Source C — which  claim s  that televised debates  are  largely  focused  on image instead of content — is noteworthy,  we  must also consider the relationship development that occurs between the constituent and the politician.  For example, consider  the story of Walter Cronkite, who performed investigat ive  journalism on-site in Vietnam to deliver a message about his opinion of the war. In doing so, he was able to shift the support for the ongoing war into a national call for closure, resulting in the end of the United States ’  presence in Vietnam and potentially saving thousands  of  live s  (Source E) . For presidents, their arguments, vision, and speeches can establish trust with the viewers, raising  citizens’  confidence  in their  ability  to  do the job successfully.  Though  televised appearances do result in investment in public relation campaigns and sometimes  support  an inauthentic view  of their subjects , at the same time, television serves as an important tool to connect citizens with their  president and  candidates .  

Perhaps the most  troubling   element of  televisi ng  presidential elections  is the threat  of commercialism. With the variety of issues and complaints regarding legislation and public policy, presidential candidates may use their live airtime to tackle only the most popular economic and social issues. T ed Koppel  analyzed  this phenomenon  during a past presidential debate,  in which  the television station structured the debate to limit responses from the candidates (Source F) .  This approach is somewhat deceptive, forcing the candidates to come up with quick answers  while  masking other issues.  For example,  only the most popular social issues may have been brought up, sidelining  complex political matters and policy problems  that may have been ongoing for years.  However, while this  format  surely limits candidates ’ ability  to share their opinions on a wide variety of issues, television does allow  the candidates to connect with the masses, which may not be possible through other forms of communication.  I f necessary , the format  of future debates  could be restructured to create  more  space for complex  argumentation   without sacrificing the benefits of televised  communication.  

In summary, t he  influence of television is unprecedented, allowing presidential candidates and other politicians to connect with viewers from across the nation. The critics are justified in  remarking   that  televised debates  may mislead  citizens through their  emphasis on  public image. However,  if audiences  analyz e  the debates, announcements, and other  such  matters with a critical approach,  this highly accessible form of communication  encourages people to build trust with presidential candidates, enhance their worldview, and feel more involved in political matters.  

Works cited

“AP English Language.” AP Central , 13 Aug. 2020, apcentral.collegeboard.org/courses/ap-english-language-and-composition/exam.

“AP English Language and Composition Free-Response Questions Scoring Rubrics, Effective Fall 2019.” The College Board, 2019, https://apcentral.collegeboard.org/pdf/ap-english-language-and-composition-frqs-1-2-3-scoring-rubrics.pdf

“AP English Language and Composition 2020 Free-Response Scoring Guidelines Applied to the 2019 Exam Questions.” The College Board, 2019, https://apcentral.collegeboard.org/pdf/ap-english-language-and-composition-2020-frq-scoring-guidelines-2019-exam-questions-0.pdf

Published September 8, 2020.

By Jolee McManus. Jolee earned a BA in English from the University of Georgia. She has several years of experience as a writing tutor and freelance copywriter and editor.

Common Writing Assignments, Apps & Tests

  • Analytical Essay
  • AP synthesis Essay
  • Argumentative Essay
  • Book Report
  • Compare and Contrast Essay
  • Cause and Effect Essay
  • College Admissions Essay
  • Critical Analysis Essay
  • Definition Essay
  • Descriptive Essay
  • Dissertation
  • Explanatory Essay
  • Expository Essay
  • Informative Essay
  • Narrative Essay
  • Opinion Essay
  • Personal Essay
  • Persuasive Essay
  • Reflective Essay
  • Research Paper
  • Rhetorical Analysis
  • Scholarship Essay
  • Short Essay
  • Thesis Paper

Framed paper

What’s included with a Chegg Writing subscription

  • Unlimited number of paper scans
  • Plagiarism detection: Check against billions of sources
  • Expert proofreading for papers on any subject
  • Grammar scans for 200+ types of common errors
  • Automatically create & save citations in 7,000+ styles
  • Cancel subscription anytime, no obligation

How to Synthesize Written Information from Multiple Sources

Shona McCombes

Content Manager

B.A., English Literature, University of Glasgow

Shona McCombes is the content manager at Scribbr, Netherlands.

Learn about our Editorial Process

Saul McLeod, PhD

Editor-in-Chief for Simply Psychology

BSc (Hons) Psychology, MRes, PhD, University of Manchester

Saul McLeod, PhD., is a qualified psychology teacher with over 18 years of experience in further and higher education. He has been published in peer-reviewed journals, including the Journal of Clinical Psychology.

On This Page:

When you write a literature review or essay, you have to go beyond just summarizing the articles you’ve read – you need to synthesize the literature to show how it all fits together (and how your own research fits in).

Synthesizing simply means combining. Instead of summarizing the main points of each source in turn, you put together the ideas and findings of multiple sources in order to make an overall point.

At the most basic level, this involves looking for similarities and differences between your sources. Your synthesis should show the reader where the sources overlap and where they diverge.

Unsynthesized Example

Franz (2008) studied undergraduate online students. He looked at 17 females and 18 males and found that none of them liked APA. According to Franz, the evidence suggested that all students are reluctant to learn citations style. Perez (2010) also studies undergraduate students. She looked at 42 females and 50 males and found that males were significantly more inclined to use citation software ( p < .05). Findings suggest that females might graduate sooner. Goldstein (2012) looked at British undergraduates. Among a sample of 50, all females, all confident in their abilities to cite and were eager to write their dissertations.

Synthesized Example

Studies of undergraduate students reveal conflicting conclusions regarding relationships between advanced scholarly study and citation efficacy. Although Franz (2008) found that no participants enjoyed learning citation style, Goldstein (2012) determined in a larger study that all participants watched felt comfortable citing sources, suggesting that variables among participant and control group populations must be examined more closely. Although Perez (2010) expanded on Franz’s original study with a larger, more diverse sample…

Step 1: Organize your sources

After collecting the relevant literature, you’ve got a lot of information to work through, and no clear idea of how it all fits together.

Before you can start writing, you need to organize your notes in a way that allows you to see the relationships between sources.

One way to begin synthesizing the literature is to put your notes into a table. Depending on your topic and the type of literature you’re dealing with, there are a couple of different ways you can organize this.

Summary table

A summary table collates the key points of each source under consistent headings. This is a good approach if your sources tend to have a similar structure – for instance, if they’re all empirical papers.

Each row in the table lists one source, and each column identifies a specific part of the source. You can decide which headings to include based on what’s most relevant to the literature you’re dealing with.

For example, you might include columns for things like aims, methods, variables, population, sample size, and conclusion.

For each study, you briefly summarize each of these aspects. You can also include columns for your own evaluation and analysis.

summary table for synthesizing the literature

The summary table gives you a quick overview of the key points of each source. This allows you to group sources by relevant similarities, as well as noticing important differences or contradictions in their findings.

Synthesis matrix

A synthesis matrix is useful when your sources are more varied in their purpose and structure – for example, when you’re dealing with books and essays making various different arguments about a topic.

Each column in the table lists one source. Each row is labeled with a specific concept, topic or theme that recurs across all or most of the sources.

Then, for each source, you summarize the main points or arguments related to the theme.

synthesis matrix

The purposes of the table is to identify the common points that connect the sources, as well as identifying points where they diverge or disagree.

Step 2: Outline your structure

Now you should have a clear overview of the main connections and differences between the sources you’ve read. Next, you need to decide how you’ll group them together and the order in which you’ll discuss them.

For shorter papers, your outline can just identify the focus of each paragraph; for longer papers, you might want to divide it into sections with headings.

There are a few different approaches you can take to help you structure your synthesis.

If your sources cover a broad time period, and you found patterns in how researchers approached the topic over time, you can organize your discussion chronologically .

That doesn’t mean you just summarize each paper in chronological order; instead, you should group articles into time periods and identify what they have in common, as well as signalling important turning points or developments in the literature.

If the literature covers various different topics, you can organize it thematically .

That means that each paragraph or section focuses on a specific theme and explains how that theme is approached in the literature.

synthesizing the literature using themes

Source Used with Permission: The Chicago School

If you’re drawing on literature from various different fields or they use a wide variety of research methods, you can organize your sources methodologically .

That means grouping together studies based on the type of research they did and discussing the findings that emerged from each method.

If your topic involves a debate between different schools of thought, you can organize it theoretically .

That means comparing the different theories that have been developed and grouping together papers based on the position or perspective they take on the topic, as well as evaluating which arguments are most convincing.

Step 3: Write paragraphs with topic sentences

What sets a synthesis apart from a summary is that it combines various sources. The easiest way to think about this is that each paragraph should discuss a few different sources, and you should be able to condense the overall point of the paragraph into one sentence.

This is called a topic sentence , and it usually appears at the start of the paragraph. The topic sentence signals what the whole paragraph is about; every sentence in the paragraph should be clearly related to it.

A topic sentence can be a simple summary of the paragraph’s content:

“Early research on [x] focused heavily on [y].”

For an effective synthesis, you can use topic sentences to link back to the previous paragraph, highlighting a point of debate or critique:

“Several scholars have pointed out the flaws in this approach.” “While recent research has attempted to address the problem, many of these studies have methodological flaws that limit their validity.”

By using topic sentences, you can ensure that your paragraphs are coherent and clearly show the connections between the articles you are discussing.

As you write your paragraphs, avoid quoting directly from sources: use your own words to explain the commonalities and differences that you found in the literature.

Don’t try to cover every single point from every single source – the key to synthesizing is to extract the most important and relevant information and combine it to give your reader an overall picture of the state of knowledge on your topic.

Step 4: Revise, edit and proofread

Like any other piece of academic writing, synthesizing literature doesn’t happen all in one go – it involves redrafting, revising, editing and proofreading your work.

Checklist for Synthesis

  •   Do I introduce the paragraph with a clear, focused topic sentence?
  •   Do I discuss more than one source in the paragraph?
  •   Do I mention only the most relevant findings, rather than describing every part of the studies?
  •   Do I discuss the similarities or differences between the sources, rather than summarizing each source in turn?
  •   Do I put the findings or arguments of the sources in my own words?
  •   Is the paragraph organized around a single idea?
  •   Is the paragraph directly relevant to my research question or topic?
  •   Is there a logical transition from this paragraph to the next one?

Further Information

How to Synthesise: a Step-by-Step Approach

Help…I”ve Been Asked to Synthesize!

Learn how to Synthesise (combine information from sources)

How to write a Psychology Essay

Print Friendly, PDF & Email

Synthesis Essay

Caleb S.

Writing a Perfect Synthesis Essay: Definition & Examples

16 min read

Published on: Mar 1, 2023

Last updated on: Jul 24, 2024

Synthesis Essay

People also read

Interesting Synthesis Essay Topics You Must Consider

Synthesis Essay Examples: Learn From Powerful Example

Share this article

Do you have a ton of research to synthesize but don't know how? Or maybe you're not sure what a synthesis essay is and how to write a good synthesis essay. 

We know writing a synthesis essay is not an easy task to do; it’s challenging for most of us. But it can be perfectly done with the right guidance and preparation. 

In this blog, we'll walk you through all the necessary information to craft a perfect synthesis essay. So you can get done with your assignments confidently! 

Let’s get started.

On This Page On This Page -->

What is a Synthesis Essay?

Synthesis essay definition states:

It is a piece of writing that takes a unique perspective on a central idea, topic, or theme. Then backs it up with evidence from multiple sources.

A synthesis essay is an important part of academic writing. The main purpose of this essay is to show your ability to prove an argument.

To make sense of these arguments, you need to use different credible sources. It demonstrates your basic understanding of the main subject. This type of essay help to enhance your critical, analytical, and research skills.

A synthesis essay is made up of ideas and conclusions based on the information reviewed. Also, this essay asks you to summarize the topic and add your own thoughts about it in relation to what you have read.

Furthermore, the synthesis essays can be similar to analytical essays , argumentative essays , or compare and contrast essays .

Synthesis Essay Types

There are three types of a synthesis essay:

1. Argument Synthesis Essay

This essay's purpose is to debate or argue on a certain topic or issue. It justifies its claims by providing evidence in the body of the essay.

In contrast to the explanatory essay, you will perform the same thing as if you were writing a typical argumentative paper. First, state your argument, make supporting statements, and back up each claim with reliable facts.

2. Review Essay

A review essay is frequently written as a preparatory essay to an argument synthesis. Review essays are commonly used in social science and medicine classes.

It is a discussion of what has already been published on a topic, with a critical examination of the sources mentioned.

An unwritten thesis statement is added to it, which is not final and indicates that further study is needed in that area.

3. Explanatory Synthesis Essay

In this essay, the writer helps the reader to grasp deeper knowledge about the topic. Rather than arguing or debating on some points, the goal of this essay is to explain a certain topic.

Like any other essay, it needs backing up with supporting claims and credible sources.

How to Start a Synthesis Essay?

The following are some helpful techniques for writing an essay. These will help you start the process and avoid common errors that plague many writers.

1. Choosing a Synthesis Essay Topic 

A prompt for a synthesis paper must be arguable. Based on your project, you may be required to select primary content. Select a book that may include contrasting perspectives. Here are some important tips for choosing a topic for a synthesis essay.

  • Look through the themes and ideas. Read from sources and investigate specific topics thoroughly to see if any of them catch your interest.
  • Select a topic and collect relevant and valuable references for your synthesis paper.
  • Outline your synthesis essay using concepts or ideas from the sources. This should make writing a lot simpler and save you a lot of time.

It is necessary to find an arguable topic to make your synthesis essay effective. Another reason is that these topics have been discussed in public for decades. 

Examples of good synthesis essay topics are;

  • The process of hiring in the age of social media
  • Social networks promote suicide
  • Should higher education be free?
  • Is it necessary to remove marks in education 
  • The importance of getting a good education
  • 3D printers are not used efficiently nowadays.
  • Is technology really helping people?
  • Why has technology made surgery safe and effective?
  • What is the cause of widespread obesity in teens?
  • What is the role of gender today?

2. Analyze Your Topic

Here's how you can fully understand your synthesis essay topic.

  • Grasp the Idea of a Synthesis Essay

A synthesis essay's purpose is to establish meaningful connections between sections of a work. When conducting research on a topic, you have to look for connections to build a strong viewpoint on the subject. The ultimate goal of the essay is to present and prove a claim about a topic .

  • Select a Topic Appropriate for a Synthesis Essay

The subject and topic must be extensive enough to include multiple relevant sources. If you have a free hand in deciding what to write about, some preparatory research may assist you in researching and choosing the right topic. 

  •  Select and Study Your Sources Carefully

Research and find relevant information and sources. Generally, choose at least three references for your essay. It's a good idea to learn one or two additional sources for better understanding but no matter what it is, make sure that you study it properly.

Remember that it is better to read three sources properly than five sources poorly.

Compile each source by writing notes in the margins. This allows you to keep track of your thoughts, fresh ideas, and so on. 

Order Essay

Paper Due? Why Suffer? That's our Job!

  • Reread the Source Material 

Reread your source material for elements that will help to support your argument. 

Examine your sources for important statements, figures, thoughts, and facts that support your thesis. Make a note of them when you come across them. This will be very useful throughout your writing process. 

3. Develop a Thesis Statement 

Your thesis statement will be the central idea of your essay. It should cover the topic and express your viewpoint on it. After reading the sources and conducting your research, form an opinion on your topic. 

It should be stated as a complete sentence. Based on the essay, your thesis statement could be the first sentence of the essay or the last sentence of the first paragraph.

  • Structure Your Thesis Statement Creatively 

To present your thesis, use a more creative structure. You can use a more elaborate structure than the one outlined above. You can develop your essay using the following approaches:

Straw man: In this approach, you will present the counter-arguments first. Then demonstrate their weaknesses and flaws. 

Such an approach demonstrates your awareness of the opposition as well as your readiness to respond to it. You present the counter-argument immediately following your thesis statement, followed by evidence to refute it. And conclude with a positive argument that supports your thesis.

Concession: In structure, concessions in essays are similar to the straw man. But this approach acknowledges the validity of the counter-argument while demonstrating that your argument is stronger. This structure is suitable for presenting papers to readers who hold opposing views. 

Illustration/ Example: It could be a thorough narrative, synopsis, or quotation from your source material that provides support for your position. However, you should not make your paper a collection of examples at the expense of supporting your thesis statement.

Comparison and Contrast: In this approach, similarities and differences between two subjects or sources demonstrate both aspects. It requires a thorough reading of your source material to identify both subtle and major points of comparison.

This type of essay can present its arguments source by source or by points of similarity or difference.

4. Create an Outline for Your Essay

An essay outline is a method for outlining the framework of your essay. Here's what you have to do. Outlining can help you structure and plan your synthesis paper. 

The standard outline of a synthesis essay is divided into three sections:

- Introduce your topic and thesis statement 
- Discuss one point related to your thesis statement 
- Discuss another point related to your thesis statement 
- Discuss yet another point related to your thesis statement 
- Summarize your points and reiterate why they support your thesis statement  

Need detailed guidance on how to write a synthesis essay? Check out this video?

How to Write a Synthesis Essay?

For writing a great essay, you have to do extensive research on your subject. This essay connects sections of multiple works and develops a strong viewpoint on a subject.

There are some major steps of the process:

1. Start Writing Your Essay 

After getting done with the preparation part, start to write your synthesis essay. 

2. Write Your First Draft Using Your Outline as a Guide

But be prepared to change your strategy if you discover fresh ideas and information. And make sure it supports your thesis and the source material. 

Your essay should have an introduction paragraph with your thesis statement at the end of it. A body with evidence that supports your main topic and thesis statement. Lastly, a conclusion that summarizes your point of view.

3. Use Transitions 

To make the content flow logically, use transitions between paragraphs. Transition words are an excellent method to highlight areas where your sources complement one another. 

Longer quotes of three lines or more should be presented as block quotes to draw emphasis to them.

4. Wrap Up Your Essay 

Here you have completed the writing process, but still, you need to make sure that your essay is flawless. 

5. Revise Your Essay

This is the time to enhance transitions between points and paragraphs and to reinforce arguments. You should strive to make your argument as concise and clear to understand as possible. It is beneficial to read your essay aloud so you can spot problematic phrases or unclear ideas.

Request someone else to proofread your paper. Have you heard the cliche "two heads are better than one"? Is it still valid?

Ask a friend or coworker what they would add or eliminate from the paper. Most importantly, does your thesis statement make sense, and are your references clearly supporting it?

Answer these questions in your essay.

6. Proofread Your Content

Examine your document for any grammatical, punctuation, or spelling mistakes. 

Are all the terms, names, and words accurately spelled? Are there any extraneous English language or sentence fragments? As you go, correct them.

Read the essay loudly to ensure that you don't accidentally add or remove words when reading in your mind. If possible, ask a friend or classmate to edit your writing.

7. Must Cite Sources

Use footnotes to mention information in the body paragraph and bibliography of cited books at the conclusion. Footnotes and in-text citations should be used for any information that is quoted, paraphrased, or cited.

8. Title Your Essay 

The point of view expressed in your thesis statement and supporting arguments should be reflected in your title. Therefore, choose a title that suits your essay rather than constructing your essay to fit the title.

Synthesis Essay Format

The format of your synthesis paper is chosen by your high school, college, or university professor. MLA, APA, and Chicago styles are the most often used styles.

The APA format is followed in the disciplines of science, education, and psychology. Chicago is commonly followed in the field of history, fine arts, and business. And MLA is the style of citation used in the humanities.

APA Style Format

The following are some APA style important details:

  • Add a page header to the top of each page.
  • Times New Roman, 1" margins, 12 pt. Font, double-spaced.
  • The format of a synthesis essay should be separated into four sections: title page, abstract, main body, and references.
  • Insert a page number in the upper right corner.

Chicago Style Format

The following are some Chicago style key points:

  • Use double-spacing between the paper's lines.
  • Make margins of one inch.
  • Font size: 12 pt. Times New Roman font style.
  • Create text that is left-justified with a rugged edge.
  • Mention the full name of a person, place, or organization.
  • At the start of the paragraph, use half-inch indents.
  • The bibliography should be on its own page.

MLA Style Format

The following are some MLA style significant points:

  • The title must be centered.
  • Font: Times New Roman, 1" margins, 12 pt font size, double-spaced
  • Mention your name, professor's name, the course number, and the date (dd/mm/yy).
  • On each page, the top right corner displays the last name and page number.
  • The final page provides a "Works Cited" list.

Synthesis Essay Rubric

A rubric is essentially a list of criteria that your professor will use to grade your paper. 

Knowing how each criterion is weighted can help make sure you get the best grade possible on your synthesis essay. 

The Basics of the Synthesis Essay Rubric

The basic elements of any synthesis essay rubric include organization, focus/development, and language use/style. 

  • Organization refers to how well you structure your paper. It should flow logically and have clear transitions between sections. 
  • Focus/development looks at how well you develop your argument throughout the paper. Are you able to clearly explain why each point supports your thesis?
  • Language use/style focuses on grammar, punctuation, and spelling. Was the paper proofread thoroughly or did careless errors slip in?

For example , your synthesis essay thesis statement is

"Capital punishment should be abolished in all states." 

Do you provide evidence from different angles, such as legal history, religious beliefs, or moral arguments to back up this claim? 

Does this evidence prove why capital punishment should be abolished?

How to Write a Synthesis Essay - Ap Lang

Are you an AP Lang student who's been assigned the dreaded synthesis essay? Here's how to write a successful synthesis essay for AP Lang. 

  • Understand the Prompt 

The first step in writing any synthesis essay is to read and understand the prompt. It's also important to note any specific requirements such as word count, formatting style, or sources that must be used in your essay. 

  • Organize Your Argument 

Once you have all the information necessary, it's time to start organizing your argument.

Start by identifying any common themes or ideas between the various sources of evidence and create an outline with these points at its core. 

  • Write Your Essay 

Now comes the fun part - writing! 

You should now have a comprehensive outline of all the points and evidence you want to include in your essay. So use this as a guide when crafting your argument. 

Make sure that each point has supporting evidence from credible sources and that everything flows logically from one point to another. 

Finally, don't forget to proofread and edit before submitting so that there are no errors in grammar or spelling. These small details can make all the difference! 

Synthesis Essay Tips

Working on a synthesis paper requires a thorough study of a particular given prompt. To evaluate it properly, you must first understand the prompt's goal, argument, author's claim, and rhetoric.

To compose a successful synthesis essay, here are some helpful tips to keep in mind.

  • Use Multiple Reasons

It is well recognized that the use of various reasons (generally two) is a very successful approach.

Present one argument against your strong thesis statement. This type of evidence presents an introduction and description. The advantage of this method is to teach awareness of the other side of the argument. It is followed by the opposing view and a decisive factor.

This is one of the most basic ways of organizing. It enables you to summarise the sources that are most relevant to you. The problem is that this technique excludes any of your individual thinking.

  • Compare and Contrast

Comparing reveals similarities, while contrasting reveals distinctions. It is feasible to show an in-depth analysis of your chosen topic. It allows writers to compare and contrast two sources at the same time.

Write quotations from sources in your own words. This approach also allows the usage of quotable sources. Ensure to cite the reference when you use the reference.

This method depicts the opposing point of view. It demonstrates that the positives outweigh the negatives.

Writing a synthesis essay is not as difficult as it may seem. You can also try our AI essay writer to generate plagiarism-free content and make the process easier. 

However, if you are having trouble understanding the concepts or writing a synthesis essay, it is best to hire professionals.

Our synthesis essay writing service is the perfect solution to your problems. We have a team of skilled writers who will help you through each step of the essay-writing process.

You contact our professionals at CollegeEssay.org to get essay writing help online . Our essay writer service is always ready to ace your assignments. 

So don't hesitate and order your essay now!

Frequently Asked Questions

How do you end a synthesis essay.

A strong ending fulfills these 3 things: 

  • Restate your thesis. 
  • Summarize or synthesize key points. 
  • Make your argument's context explicit. 

What is a synthesis paragraph?

A synthesis is a textual debate that includes support from multiple sources with opposing viewpoints. This type of work requires analysis by using different sources and determining their relevance to your thesis.

Why is synthesis important?

It is important because it allows us to: 

  • Test and validate hypotheses. 
  • Comprehend key processes. 
  • Plan future research efforts. 

How to conclude a synthesis essay?

Synthesize rather than summarize your argument. No need to go over your entire paper again. Instead, include a brief summary of the main points of the paper and explain to your reader how you've made points.

What is an example of a synthesis?

Making connections or putting things together is all that is required. We naturally synthesize information to assist others in seeing connections between things. For example, synthesis occurs when you report to a friend what other friends have said about a film or book.

How many paragraphs is a synthesis essay?

According to the standard outline provided, you should stick to the basic five-to-six paragraph structure. In rare cases, there may be more paragraphs in the main body.

Caleb S. (Literature, Marketing)

Caleb S. has extensive experience in writing and holds a Masters from Oxford University. He takes great satisfaction in helping students exceed their academic goals. Caleb always puts the needs of his clients first and is dedicated to providing quality service.

Paper Due? Why Suffer? That’s our Job!

Get Help

Keep reading

Synthesis Essay

Legal & Policies

  • Privacy Policy
  • Cookies Policy
  • Terms of Use
  • Refunds & Cancellations
  • Our Writers
  • Success Stories
  • Our Guarantees
  • Affiliate Program
  • Referral Program
  • AI Essay Writer

Disclaimer: All client orders are completed by our team of highly qualified human writers. The essays and papers provided by us are not to be used for submission but rather as learning models only.

what is the synthesis in an essay

We apologize for any inconvenience as we update our site to a new look.

what is the synthesis in an essay

  • Walden University
  • Faculty Portal

Using Evidence: Synthesis

Synthesis video playlist.

Note that these videos were created while APA 6 was the style guide edition in use. There may be some examples of writing that have not been updated to APA 7 guidelines.

Basics of Synthesis

As you incorporate published writing into your own writing, you should aim for synthesis of the material.

Synthesizing requires critical reading and thinking in order to compare different material, highlighting similarities, differences, and connections. When writers synthesize successfully, they present new ideas based on interpretations of other evidence or arguments. You can also think of synthesis as an extension of—or a more complicated form of—analysis. One main difference is that synthesis involves multiple sources, while analysis often focuses on one source.

Conceptually, it can be helpful to think about synthesis existing at both the local (or paragraph) level and the global (or paper) level.

Local Synthesis

Local synthesis occurs at the paragraph level when writers connect individual pieces of evidence from multiple sources to support a paragraph’s main idea and advance a paper’s thesis statement. A common example in academic writing is a scholarly paragraph that includes a main idea, evidence from multiple sources, and analysis of those multiple sources together.

Global Synthesis

Global synthesis occurs at the paper (or, sometimes, section) level when writers connect ideas across paragraphs or sections to create a new narrative whole. A literature review , which can either stand alone or be a section/chapter within a capstone, is a common example of a place where global synthesis is necessary. However, in almost all academic writing, global synthesis is created by and sometimes referred to as good cohesion and flow.

Synthesis in Literature Reviews

While any types of scholarly writing can include synthesis, it is most often discussed in the context of literature reviews. Visit our literature review pages for more information about synthesis in literature reviews.

Related Webinars

Webinar

Didn't find what you need? Email us at [email protected] .

  • Previous Page: Analysis
  • Next Page: Citing Sources Properly
  • Office of Student Disability Services

Walden Resources

Departments.

  • Academic Residencies
  • Academic Skills
  • Career Planning and Development
  • Customer Care Team
  • Field Experience
  • Military Services
  • Student Success Advising
  • Writing Skills

Centers and Offices

  • Center for Social Change
  • Office of Academic Support and Instructional Services
  • Office of Degree Acceleration
  • Office of Research and Doctoral Services
  • Office of Student Affairs

Student Resources

  • Doctoral Writing Assessment
  • Form & Style Review
  • Quick Answers
  • ScholarWorks
  • SKIL Courses and Workshops
  • Walden Bookstore
  • Walden Catalog & Student Handbook
  • Student Safety/Title IX
  • Legal & Consumer Information
  • Website Terms and Conditions
  • Cookie Policy
  • Accessibility
  • Accreditation
  • State Authorization
  • Net Price Calculator
  • Contact Walden

Walden University is a member of Adtalem Global Education, Inc. www.adtalem.com Walden University is certified to operate by SCHEV © 2024 Walden University LLC. All rights reserved.

Have a language expert improve your writing

Run a free plagiarism check in 10 minutes, generate accurate citations for free.

  • Knowledge Base
  • Working with sources
  • Synthesizing Sources | Examples & Synthesis Matrix

Synthesizing Sources | Examples & Synthesis Matrix

Published on July 4, 2022 by Eoghan Ryan . Revised on May 31, 2023.

Synthesizing sources involves combining the work of other scholars to provide new insights. It’s a way of integrating sources that helps situate your work in relation to existing research.

Synthesizing sources involves more than just summarizing . You must emphasize how each source contributes to current debates, highlighting points of (dis)agreement and putting the sources in conversation with each other.

You might synthesize sources in your literature review to give an overview of the field or throughout your research paper when you want to position your work in relation to existing research.

Table of contents

Example of synthesizing sources, how to synthesize sources, synthesis matrix, other interesting articles, frequently asked questions about synthesizing sources.

Let’s take a look at an example where sources are not properly synthesized, and then see what can be done to improve it.

This paragraph provides no context for the information and does not explain the relationships between the sources described. It also doesn’t analyze the sources or consider gaps in existing research.

Research on the barriers to second language acquisition has primarily focused on age-related difficulties. Building on Lenneberg’s (1967) theory of a critical period of language acquisition, Johnson and Newport (1988) tested Lenneberg’s idea in the context of second language acquisition. Their research seemed to confirm that young learners acquire a second language more easily than older learners. Recent research has considered other potential barriers to language acquisition. Schepens, van Hout, and van der Slik (2022) have revealed that the difficulties of learning a second language at an older age are compounded by dissimilarity between a learner’s first language and the language they aim to acquire. Further research needs to be carried out to determine whether the difficulty faced by adult monoglot speakers is also faced by adults who acquired a second language during the “critical period.”

Prevent plagiarism. Run a free check.

To synthesize sources, group them around a specific theme or point of contention.

As you read sources, ask:

  • What questions or ideas recur? Do the sources focus on the same points, or do they look at the issue from different angles?
  • How does each source relate to others? Does it confirm or challenge the findings of past research?
  • Where do the sources agree or disagree?

Once you have a clear idea of how each source positions itself, put them in conversation with each other. Analyze and interpret their points of agreement and disagreement. This displays the relationships among sources and creates a sense of coherence.

Consider both implicit and explicit (dis)agreements. Whether one source specifically refutes another or just happens to come to different conclusions without specifically engaging with it, you can mention it in your synthesis either way.

Synthesize your sources using:

  • Topic sentences to introduce the relationship between the sources
  • Signal phrases to attribute ideas to their authors
  • Transition words and phrases to link together different ideas

To more easily determine the similarities and dissimilarities among your sources, you can create a visual representation of their main ideas with a synthesis matrix . This is a tool that you can use when researching and writing your paper, not a part of the final text.

In a synthesis matrix, each column represents one source, and each row represents a common theme or idea among the sources. In the relevant rows, fill in a short summary of how the source treats each theme or topic.

This helps you to clearly see the commonalities or points of divergence among your sources. You can then synthesize these sources in your work by explaining their relationship.

Example: Synthesis matrix
Lenneberg (1967) Johnson and Newport (1988) Schepens, van Hout, and van der Slik (2022)
Approach Primarily theoretical, due to the ethical implications of delaying the age at which humans are exposed to language Testing the English grammar proficiency of 46 native Korean or Chinese speakers who moved to the US between the ages of 3 and 39 (all participants had lived in the US for at least 3 years at the time of testing) Analyzing the results of 56,024 adult immigrants to the Netherlands from 50 different language backgrounds
Enabling factors in language acquisition A critical period between early infancy and puberty after which language acquisition capabilities decline A critical period (following Lenneberg) General age effects (outside of a contested critical period), as well as the similarity between a learner’s first language and target language
Barriers to language acquisition Aging Aging (following Lenneberg) Aging as well as the dissimilarity between a learner’s first language and target language

If you want to know more about ChatGPT, AI tools , citation , and plagiarism , make sure to check out some of our other articles with explanations and examples.

  • ChatGPT vs human editor
  • ChatGPT citations
  • Is ChatGPT trustworthy?
  • Using ChatGPT for your studies
  • What is ChatGPT?
  • Chicago style
  • Paraphrasing

 Plagiarism

  • Types of plagiarism
  • Self-plagiarism
  • Avoiding plagiarism
  • Academic integrity
  • Consequences of plagiarism
  • Common knowledge

Don't submit your assignments before you do this

The academic proofreading tool has been trained on 1000s of academic texts. Making it the most accurate and reliable proofreading tool for students. Free citation check included.

what is the synthesis in an essay

Try for free

Synthesizing sources means comparing and contrasting the work of other scholars to provide new insights.

It involves analyzing and interpreting the points of agreement and disagreement among sources.

You might synthesize sources in your literature review to give an overview of the field of research or throughout your paper when you want to contribute something new to existing research.

A literature review is a survey of scholarly sources (such as books, journal articles, and theses) related to a specific topic or research question .

It is often written as part of a thesis, dissertation , or research paper , in order to situate your work in relation to existing knowledge.

Topic sentences help keep your writing focused and guide the reader through your argument.

In an essay or paper , each paragraph should focus on a single idea. By stating the main idea in the topic sentence, you clarify what the paragraph is about for both yourself and your reader.

At college level, you must properly cite your sources in all essays , research papers , and other academic texts (except exams and in-class exercises).

Add a citation whenever you quote , paraphrase , or summarize information or ideas from a source. You should also give full source details in a bibliography or reference list at the end of your text.

The exact format of your citations depends on which citation style you are instructed to use. The most common styles are APA , MLA , and Chicago .

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the “Cite this Scribbr article” button to automatically add the citation to our free Citation Generator.

Ryan, E. (2023, May 31). Synthesizing Sources | Examples & Synthesis Matrix. Scribbr. Retrieved August 12, 2024, from https://www.scribbr.com/working-with-sources/synthesizing-sources/

Is this article helpful?

Eoghan Ryan

Eoghan Ryan

Other students also liked, signal phrases | definition, explanation & examples, how to write a literature review | guide, examples, & templates, how to find sources | scholarly articles, books, etc., get unlimited documents corrected.

✔ Free APA citation check included ✔ Unlimited document corrections ✔ Specialized in correcting academic texts

Essay Papers Writing Online

Mastering the art of crafting a stellar synthesis essay – top tips, techniques, and examples to boost your writing skills and academic success.

How to write a good synthesis essay

Are you ready to embark on a journey of discovery, where you meld ideas, thoughts, and arguments into a seamless tapestry? The synthesis essay offers you a unique opportunity to showcase your ability to synthesize various sources and present your ideas in a coherent and convincing manner. In this article, we will explore some tried-and-true strategies to help you master the art of crafting a compelling synthesis essay that will leave a lasting impression on your readers.

First and foremost, it is essential to develop a strong grasp of the central theme or topic of your essay. This theme serves as the thread that will tie all the different sources and ideas together. By understanding the underlying essence of your essay, you can better navigate through the vast sea of information and select the most relevant and persuasive sources to support your arguments.

Once you have identified the central theme, it is crucial to critically analyze the various sources at your disposal. Remember, the key is not just to summarize these sources but to analyze them in relation to your thesis statement. Look for patterns, contradictions, and connections between the different sources. Highlight the key arguments and evidence that are relevant to your essay’s central theme, and be prepared to present counterarguments that address opposing viewpoints.

Understand the Prompt

In order to write an effective synthesis essay, it is crucial to fully understand the prompt provided. The prompt serves as a guide, outlining the specific topic or issue that needs to be addressed in the essay.

When analyzing the prompt, it is important to carefully examine the keywords and phrases used. These words may provide valuable insight into the expectations of the essay and the specific elements that should be included. It is also crucial to identify any limitations or guidelines outlined in the prompt.

Understanding the prompt also involves determining the purpose of the essay. Is it meant to inform, persuade, or argue a specific point? By grasping the purpose, you can tailor your writing style and arguments to best meet the objectives of the prompt.

Additionally, it is essential to consider the context and audience of the essay. Who will be reading your essay? What are their expectations and knowledge on the topic? By considering these factors, you can better adjust your writing style and tone to effectively communicate your ideas.

Overall, understanding the prompt is the first step towards writing an effective synthesis essay. By carefully analyzing the prompt, identifying key elements, and considering the purpose and audience, you can ensure that your essay is well-focused, coherent, and meets the requirements of the assignment.

Conduct Thorough Research

When it comes to crafting a compelling and well-supported synthesis essay, conducting thorough research is crucial. A successful essay requires a deep understanding of the topic at hand, as well as a comprehensive exploration of different perspectives and sources. Simply put, conducting thorough research means digging deep and gathering a wide range of relevant and reliable information that will enrich your synthesis essay and make it more convincing.

Research is the foundation on which your essay will be built. It allows you to gather facts, statistics, and expert opinions that support your thesis and strengthen your arguments. By conducting thorough research, you can demonstrate your knowledge and expertise on the topic, as well as present a well-rounded perspective that takes into account different viewpoints and evidence.

It is essential to use a variety of sources during your research process. This includes academic journals, books, reputable websites, and studies conducted by experts in the field. By consulting a diverse range of sources, you can ensure that your synthesis essay is well-informed and comprehensive.

When conducting research, it is important to critically evaluate the sources you come across. Not all sources are created equal, and it is your responsibility as an essay writer to determine their credibility and reliability. Look for sources that are peer-reviewed, published by reputable scholars or organizations, and have a track record of accuracy and reliability.

In addition to gathering information from various sources, you should also take notes and organize your research in a systematic and structured manner. This will make it easier to refer back to specific information when writing your essay and ensure that you include all relevant facts and data in your synthesis.

In conclusion, conducting thorough research is a critical step in writing an effective synthesis essay. It enables you to gather a wealth of relevant information, evaluate its credibility, and present a well-informed and comprehensive perspective on the topic. By investing time and effort into research, you can ensure that your essay is well-supported, convincing, and showcases your knowledge and understanding of the subject matter.

Create a Strong Thesis Statement

One of the most essential elements for writing a successful synthesis essay is the creation of a strong thesis statement. A thesis statement serves as the guiding principle and main argument of your essay, offering a clear and focused direction for your synthesis. This statement should be concise and powerful, encapsulating the main idea or theme that you will explore throughout your essay.

To create a strong thesis statement, it is important to consider the main points or ideas that you want to convey in your essay. Think about the connections and relationships between these points, and how they contribute to the overall theme or argument of your synthesis. Your thesis statement should reflect these connections and provide a clear stance or perspective on the topic.

Additionally, your thesis statement should be specific and avoid vague or general language. It should clearly state your main argument or position, and highlight the unique perspective or insights that you will bring to the topic. Avoid using clichés or common phrases, as they can weaken the impact of your thesis statement.

Lastly, make sure that your thesis statement is arguable. A strong thesis statement should invite discussion and debate, rather than stating an obvious or universally agreed-upon fact. It should be a statement that can be supported or refuted through evidence and logical reasoning.

By creating a strong thesis statement, you lay the foundation for a compelling and cohesive synthesis essay. It will guide your writing process and help you maintain a clear focus throughout your essay. Take the time to craft a thesis statement that is powerful, specific, and arguable, and you will set yourself up for success in writing an effective synthesis essay.

Organize Your Ideas

Organize Your Ideas

When it comes to crafting a compelling synthesis essay, one of the most important steps is organizing your ideas. Effective organization ensures that your thoughts flow smoothly and cohesively, allowing your readers to easily follow your argument. By structuring your essay in a logical and coherent manner, you can effectively convey your message and make a strong impact.

A key aspect of organizing your ideas involves creating an outline. This serves as a roadmap for your essay, helping you to visualize the overall structure and flow of your argument. Start by brainstorming your main ideas and supporting evidence, then arrange them in a logical order. This can be done using a variety of methods, such as creating a mind map or a hierarchical list.

Once you have established your outline, it’s important to consider the most effective way to present your ideas. One option is to use a chronological or sequential order, where you present your arguments in a logical progression. Another option is to use a thematic approach, grouping related ideas together to create a cohesive narrative. Whichever approach you choose, make sure to clearly introduce each main point and provide sufficient evidence to support your claims.

In addition to organizing your ideas structurally, it’s also important to consider the cohesiveness of your writing. Use transitional words and phrases to guide your readers through your argument, signaling shifts in ideas or providing connections between different points. This will help your essay to flow smoothly and prevent any misunderstandings.

Lastly, don’t forget to revise and refine your organization as you go. After completing a first draft, take the time to review your essay and make any necessary adjustments. This may involve reordering paragraphs, adding or deleting sections, or rephrasing sentences for clarity. By continuously revising and refining your organization, you can ensure that your essay is well-structured and easy to follow.

By organizing your ideas effectively, you can elevate your synthesis essay and make a strong impression on your readers. Take the time to carefully plan and structure your argument, and you’ll be well on your way to writing an impactful and persuasive essay.

Use Evidence and Examples from Various Sources

One crucial aspect of writing a synthesis essay is the use of evidence and examples from different sources to support your claims and arguments. By drawing from a variety of sources, such as scholarly articles, books, interviews, and research studies, you can strengthen the validity and credibility of your essay.

When selecting evidence and examples, it’s important to consider the diversity of viewpoints and perspectives. Including evidence from multiple sources allows you to present a well-rounded argument and demonstrate that you have considered various opinions on the topic.

Moreover, using evidence and examples from different sources helps to avoid biases and ensure that your essay is objective and comprehensive. By incorporating a variety of sources, you can present a more balanced and informed analysis.

Additionally, when using evidence and examples, be sure to provide proper citations and references. This not only gives credit to the original authors but also strengthens the credibility of your essay. Make sure to follow the appropriate citation style, such as APA or MLA, and include in-text citations and a reference list or bibliography.

In conclusion, by utilizing evidence and examples from various sources, you can enhance the effectiveness of your synthesis essay. By incorporating different viewpoints and perspectives, avoiding biases, and providing proper citations, you can create a well-supported and persuasive argument.

Related Post

How to master the art of writing expository essays and captivate your audience, convenient and reliable source to purchase college essays online, step-by-step guide to crafting a powerful literary analysis essay, unlock success with a comprehensive business research paper example guide, unlock your writing potential with writers college – transform your passion into profession, “unlocking the secrets of academic success – navigating the world of research papers in college”, master the art of sociological expression – elevate your writing skills in sociology.

what is the synthesis in an essay

VCV Rack & Modular Synthesis Series

Key concepts in video synthesis, a beginner friendly tutorial.

Michael Filimowicz, PhD

Michael Filimowicz, PhD

Sound & Design

The Core Tech

The general idea of electronic oscillators and their waveform primitives is widely understood in the realms of audio and music, whether in the context of synthesizers or just producing test tones for calibrating equipment. These waveform shapes will be very recognizable to anyone with at least some beginner’s familiarity with the audio signal space.

Video synthesis also uses oscillators, but instead of being presented through speakers for auditioning, it is sent to a visual monitor for viewing. These monitors were originally analog (just like the music synths of the era when this technology was invented) and so an oscillator’s electronic signal output would be processed by the zigzag presentation format of a CRT TV ( source ).

A CRT TV is a television device that uses cathode ray tubes. These tubes contain one or more electron guns and fluorescent screens that are used to view images.

Below is a video demonstration of analog hardware producing image patterns based on electronic oscillator signals. The key concepts illustrated in the video are:

  • Line rate : the speed of the zigzagging scan of the video monitor, which will be mathematically keyed to AC current rate (60 Hz in North America).
  • Oscillator frequency speeds : how many cycles per second the waveform produces its alternating peaks and valleys in the signal. Video signals are at much higher rates compared to audio signals. Most sound is presented for listening in the 20 Hz to 20 kHz range. Video signal oscillators may go up to 3 mHz and beyond. Megahertz, or MHz, is much faster than kilohertz — a thousand times more to be precise, or millions of cycles per second.
  • Sync : with video, there is both horizontal and vertical sync (described a bit more technically below) which work together to keep the image centered in the screen. When watching a tv show, you likely do want each frame perfectly centered in the screen where it’s supposed to be. With video synthesis, though, sync is just another creative parameter to play with. Horizontal sync resets oscillator phase on every frame, while vertical sync does so with every horizontal line. Phase, you may recall from your knowledge of acoustics or physics, indicates where we are at in the progression of the waveform at any given moment in time.
  • Combining & Modulating Frequencies : just as with audio, where complex sounds are built up out of many overtones and layered sounds, with video synthesis you can create very complex patterns out of simpler signal elements. This can happen by summing multiple signals together, or by modulating signals with other oscillator signals or control signals such as LFOs (low frequency oscillators). LFOs play a similar role in video synthesis as they do with audio synthesis — they produce regular (repeating, rhythmic) changes at a very low frequency such that the changes can actually be perceived. E.g. a 2 Hz LFO will produce a sonic or visual rhythm twice per second, which is audible or visible as a repeating change of some kind. Usually the frequencies involved with sounds and images are so fast, we cannot perceive each individual cycle and are not supposed to perceive them individually, but rather altogether as a complex composite that simply presents a sound or an image.
  • Multi-Oscillators: You will often have setups in hardware and software synths with three oscillators. In audio, this is done to enrich or ‘fatten’ the sound so that it can have a lot of spectral components and be very ‘thick’ and so on. With video, three oscillators are useful because they can be assigned to R G B (red green blue) channels of color information, similar to how in a Photoshop image, each channel of color information by itself is just greyscale information, and they only create a color image when combined.
  • Higher and Lower Signal = Brighter and Darker Visual Areas.

Here’s a handy summary of short definitions related to image presentation on electronic monitors:

Line rate : It indicates the actual speed with which the bits are sent onto the wire Frame rate : frequency at which an imaging device produces unique images(frames) Progressive video : is the method by which all lines (whole frame) are captured at the same instant, representing a single moment in time The screen aspect ratio is width divided by height, and the same for the pixel aspect ratio . Horizontal blanking interval refers to a part of the process of displaying images on a computer monitor or television screen via raster scanning. CRT screens display images by moving beams of electrons very quickly across the screen. Once the beam of the monitor has reached the edge of the screen, the beam is switched off, and the deflection circuit voltages (or currents) are returned to the values they had for the other edge of the screen; this would have the effect of retracing the screen in the opposite direction, so the beam is turned off during this time. Vertical blanking interval is an interval of time between the last line of a given frame and the beginning of the next frame, during which the incoming data stream is not displayed on a CRT screen. It is the time interval allowed for the analog TV electron gun beam to move from the bottom of the current frame to the top of the next one as it scans images. This requires the last 45 lines of each 525-line frame. ( source )

Frequencies

Here is a single red oscillator (‘osc’ for short)with a signal of ~5 Hz. Note that it is very easy to count its pulse 5 times per second, as the signal is moving between high (bright) and low (dark) values.

There are many complex interactions that occur in the inter-relatedness between frequency rates and line rates. For example, here is the same osc at 1.639 Mhz.

Now let’s look at it at 1.662 MHz, which seems like a tiny difference of only .023 MHz from the above clip, but at the frequency rate in interaction with the line rate, you get this instead:

In between these two extremes of osc frequency, here’s an example at 121.8 Hz, which seems somewhat mellow and relaxing in comparison:

Let’s get even closer to twice the electrical current rate of North American circuits (60 Hz), and compare the clip above to the one below, with an osc frequency of 120.1 Hz. You’ll see that the signal has slowed down to a crawl, and would practically be in sync (in stasis) if not for that .1 Hz difference.

Because of the 60 Hz screen refresh rate — which is not coincidentally the same as AC electrical current rate — at frequencies below 0.125 Hz you will generally just see pulsing colors, whereas above 10 Hz is where the scrolling line patterns will start to appear. As you increase the frequencies, the lines will become diagonal in orientation and ultimately at the very high ends resemble pure visual noise.

Here is a ~1 kHz osc frequency with horizontal sync applied. You’ll see that ‘sync is your friend’ when you want to impart some stability into the signal, so that it’s not constantly shifting across the screen in some basic pattern that results from the interaction of monitor line rate and osc frequency rates.

And just for good comparison, here is that same signal with vertical sync applied.

Often you will want to be either ‘close to sync’ or ‘not far from sync’ in the sense that you would like a pattern with some motion but perhaps not too much motion. As you can see, pure sync, either horizontal or vertical, will often freeze your image. I say ‘often’ because depending on the complexity of your patch, other kinds of modulation may also impart movement beyond whatever tendency towards stillness sync can provide.

Wave Shapes

We can impart the waveshape of the osc waveform into the visual pattern. Recall some basic electrical waveform shapes:

Here is what a vertically synced sine wave looks like when synthesized as video, where we see a gradual gradient happening between the brightest and darkest image areas:

Here is what a ramp or sawtooth type pattern looks like, where there is a sudden jump to the highest value and a gradient to the lowest and darkest value:

Perhaps somewhere in between these two extremes, you get the triangle pattern which has a little less sense of transition between brightest and darkest areas when compared to the sine wave pattern:

And finally, here is the square wave pattern , which is basically an either/or — full on, full off, or highest/lowest — high contrast pattern:

Depending on what tool you are using, you will likely have many options available for modulation. Typically you will be able to modulate parameters such as:

  • Oscillator frequency
  • Oscillator sync
  • Oscillator phase
  • Oscillator hue
  • The Amount of modulation (for sync, phase, frequency, hue etc.)
  • Oscillator waveform shape

Additionally, you will have sources for modulation signals. Those will often include:

  • Any oscillator, which can modulate other oscillators
  • LFOs (low frequency oscillators), along with LFO parameters such as their strength (amplitude) and frequency rate

You will generally have different kinds of sources available for video synthesis, such as:

  • The oscillators! Already discussed at length.
  • External signal from a live webcam
  • Internal video file from the hard drive
  • Displacement maps, e.g. alpha channel information or other greyscale information that can be used to displace pixels.

What we do with all of these modulations, of course, is make these rather simplistic patterns complex, and thereby convert them into visually interesting patterns.

Of course, the real magic of video synthesis is when you create complex patterns out of these elementary signal behaviors.

Here’s a simple pattern where things are a bit more complex than in the oscillator demo videos above. There are three videos below, each from the exact same patch. The videos show that over time, a pattern can evolve significantly, and in fact much of what’s interesting about video synthesis is creating patches where over a long period of time there can be quite a lot of generative evolution in the resultant imagery.

As you can do with any video signal, effects have a role to play with video synthesis. The number and possibilities of effects are infinite, or at least too infinite for this intro essay. Effect parameters can also of course be modulated by any modulation source, which increases the available complexity to draw on for your design.

Below is the same pattern as above, but with some rotation, scaling, kaleidoscopic mirroring and time delay trails applied.

Interactivity

What we have been looking at so far is primarily generative behavior of synthesized video. In other words, we set up some initial values and states, and then its signal logic auto-imparts the exact real-time rendering of its pixel play.

We can of course introduce all manner of interactivity into our video synthesis patch, using either virtual or external controllers and sensors such as MIDI hardware, audio input, proximity sensors, webcams and anything else that generates some kind of data output in response to some input, which affords interactive control.

This next video is the same patch as above, but simply adds an interactive element to its resulting output pattern.

This discussion has been kept at a very high level suitable for introductory coverage. The exact look and technical possibilities will depend on which tool you are using. Even though video synthesis originated in the analog hardware realm, its processes and aesthetics are emulated often in the software domain. Here are some tools you may want to look at to explore video synthesis further:

  • VSynth package for the Max programming environment.
  • Python 3 & Pygame
  • Hydra , live coding for visuals framework
  • Chromagnon hardware video synth
  • Vidiot hardware video synth
  • Eyesy hardware video synth
  • Rhythmscope hardware synth
  • Lumen software synth, Mac only

Related Articles

East Coast vs West Coast Synthesis | a bit of history

VCV Rack Module Reference

Adding Plugins to VCV Rack

Starting From Zero with Modular Synthesis and VCV Rack

Starting with the Starter Patch in VCV Rack

Voltage Control Visualization in VCV Rack

Visualizing Polyphony Arrays in VCV Rack

Gates and Triggers in VCV Rack

Cabling Conventions in VCV Rack | a user interface note

Gates and Envelopes in VCV Rack

Michael Filimowicz, PhD

Written by Michael Filimowicz, PhD

School of Interactive Arts & Technology (SIAT) Simon Fraser University https://www.youtube.com/@MykEff amazon.com/author/michaelfilimowicz

Text to speech

what is the synthesis in an essay

Democracy challenged

‘A Crisis Coming’: The Twin Threats to American Democracy

Credit... Photo illustration by Matt Chase

Supported by

  • Share full article

David Leonhardt

By David Leonhardt

David Leonhardt is a senior writer at The Times who won the Pulitzer Prize for his coverage of the Great Recession.

  • Published Sept. 17, 2022 Updated June 21, 2023

Listen to This Article

The United States has experienced deep political turmoil several times before over the past century. The Great Depression caused Americans to doubt the country’s economic system. World War II and the Cold War presented threats from global totalitarian movements. The 1960s and ’70s were marred by assassinations, riots, a losing war and a disgraced president.

These earlier periods were each more alarming in some ways than anything that has happened in the United States recently. Yet during each of those previous times of tumult, the basic dynamics of American democracy held firm. Candidates who won the most votes were able to take power and attempt to address the country’s problems.

The current period is different. As a result, the United States today finds itself in a situation with little historical precedent. American democracy is facing two distinct threats, which together represent the most serious challenge to the country’s governing ideals in decades.

The first threat is acute: a growing movement inside one of the country’s two major parties — the Republican Party — to refuse to accept defeat in an election.

The violent Jan. 6, 2021, attack on Congress , meant to prevent the certification of President Biden’s election, was the clearest manifestation of this movement, but it has continued since then. Hundreds of elected Republican officials around the country falsely claim that the 2020 election was rigged. Some of them are running for statewide offices that would oversee future elections, potentially putting them in position to overturn an election in 2024 or beyond.

“There is the possibility, for the first time in American history, that a legitimately elected president will not be able to take office,” said Yascha Mounk, a political scientist at Johns Hopkins University who studies democracy.

Vote Margins by State in Presidential Elections since 1988

Senate representation by state.

Residents of less populated states like Wyoming and North Dakota, who are disproportionately white, have outsize influence.

what is the synthesis in an essay

1 voter in Wyoming

has similar representation as

1 voter in North Dakota

6 voters in Connecticut

7 voters in Alabama

18 voters in Michigan

59 voters in California

what is the synthesis in an essay

has similar

representation as

Landslides in 2020 House Elections

There were about twice as many districts where a Democratic House candidate won by at least 50 percentage points as there were districts where a Republican candidate won by as much.

what is the synthesis in an essay

Landslide (one candidate won

by at least 50 percentage points)

Barbara Lee

Calif. District 13

Jerry Nadler

N.Y. District 10

Diana DeGette

Colo. District 1

Donald Payne Jr.

N.J. District 10

Jesús García

Ill. District 4

what is the synthesis in an essay

Landslide (one candidate won by at least 50 percentage points)

Presidential Appointments of Supreme Court Justices

what is the synthesis in an essay

Supreme Court appointments

Presidential election winners

Popular vote

Electoral College

Party that nominated a justice

David H. Souter (until 2009)

Clarence Thomas

Ruth Bader Ginsburg (until 2020)

Stephen G. Breyer (until 2022)

John G. Roberts Jr.

Samuel A. Alito Jr.

Sonia Sotomayor

Elena Kagan

Neil M. Gorsuch

Brett M. Kavanaugh

Amy Coney Barrett

Ketanji Brown Jackson

what is the synthesis in an essay

Supreme Court

Presidential election

nominated a justice

Souter (until 2009)

Ginsburg (until 2020)

Breyer (until 2022)

State Legislators and Election Lies

The share of Republican state legislators who have taken steps, as of May 2022, to discredit or overturn the 2020 presidential election results

what is the synthesis in an essay

Pennsylvania

what is the synthesis in an essay

We are having trouble retrieving the article content.

Please enable JavaScript in your browser settings.

Thank you for your patience while we verify access. If you are in Reader mode please exit and  log into  your Times account, or  subscribe  for all of The Times.

Thank you for your patience while we verify access.

Already a subscriber?  Log in .

Want all of The Times?  Subscribe .

Advertisement

what is the synthesis in an essay

Maintenance work is planned from 21:00 BST on Sunday 18th August 2024 to 21:00 BST on Monday 19th August 2024, and on Thursday 29th August 2024 from 11:00 to 12:00 BST.

During this time the performance of our website may be affected - searches may run slowly, some pages may be temporarily unavailable, and you may be unable to log in or to access content. If this happens, please try refreshing your web browser or try waiting two to three minutes before trying again.

We apologise for any inconvenience this might cause and thank you for your patience.

what is the synthesis in an essay

Efficient circular RNA synthesis through Gap-DNA splint-mediated ligation †

ORCID logo

* Corresponding authors

a Department of Chemical Engineering, University of Seoul, 163 Seoulsiripdaero, Dongdaemun-gu, Seoul 02504, Republic of Korea E-mail: [email protected]

The COVID-19 pandemic heightened interest in circular RNA (C-RNA) for RNA therapeutics, offering advantages over linear mRNAs. Circular mRNA facilitates uncapped molecule development, and C-RNAs ensure stability in RNA interference therapeutics. The synthesis method, RNA ligation, is employed in C-RNA-based therapeutics. Stable DNA–RNA hybrid constructs enable efficient RNA ligase-based circularization.

Graphical abstract: Efficient circular RNA synthesis through Gap-DNA splint-mediated ligation

Supplementary files

  • Supplementary information PDF (406K)

Article information

Download citation, permissions.

what is the synthesis in an essay

Efficient circular RNA synthesis through Gap-DNA splint-mediated ligation

H. Kim, D. Kim, S. Moon and J. B. Lee, Nanoscale , 2024, Advance Article , DOI: 10.1039/D4NR01770F

To request permission to reproduce material from this article, please go to the Copyright Clearance Center request page .

If you are an author contributing to an RSC publication, you do not need to request permission provided correct acknowledgement is given.

If you are the author of this article, you do not need to request permission to reproduce figures and diagrams provided correct acknowledgement is given. If you want to reproduce the whole article in a third-party publication (excluding your thesis/dissertation for which permission is not required) please go to the Copyright Clearance Center request page .

Read more about how to correctly acknowledge RSC content .

Social activity

Search articles by author.

This article has not yet been cited.

Advertisements

Information

  • Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

  • Active Journals
  • Find a Journal
  • Proceedings Series
  • For Authors
  • For Reviewers
  • For Editors
  • For Librarians
  • For Publishers
  • For Societies
  • For Conference Organizers
  • Open Access Policy
  • Institutional Open Access Program
  • Special Issues Guidelines
  • Editorial Process
  • Research and Publication Ethics
  • Article Processing Charges
  • Testimonials
  • Preprints.org
  • SciProfiles
  • Encyclopedia

biology-logo

Article Menu

what is the synthesis in an essay

  • Subscribe SciFeed
  • Recommended Articles
  • Google Scholar
  • on Google Scholar
  • Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Corazonin stimulates ecdysteroid synthesis during the molting process of the swimming crab, portunus trituberculatus.

what is the synthesis in an essay

Simple Summary

1. introduction, 2. materials and methods, 2.1. experimental animals, 2.2. in vitro treatments, 2.3. in vivo treatments, 2.4. determination of ecdysteroid levels, 2.5. gene expression analysis, 2.6. statistical analysis, 3.1. expression profiles of ptcrz and ptcrzr during the molt cycle, 3.2. effects of ptcrz peptide and dsptcrzr on ecdysteroid synthesis in vitro, 3.3. effects of ptcrz peptide and dsptcrzr on ecdysteroid synthesis in vivo, 3.4. effects of ptcrz/ptcrzr signaling on pteth expression, 4. discussion, 5. conclusions, supplementary materials, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

  • Veenstra, J.A. Isolation and structure of Corazonin, a cardioactive peptide from the American cockroach. FEBS Lett. 1989 , 250 , 231–234. [ Google Scholar ] [ CrossRef ]
  • Hillyer, J.F.; Estévez-Lao, T.Y.; Funkhouser, L.J.; Aluoch, V.A. Anopheles gambiae Corazonin: Gene structure, expression and effect on mosquito heart physiology. Insect. Mol. Biol. 2012 , 21 , 343–355. [ Google Scholar ] [ CrossRef ]
  • Alexander, J.L.; Oliphant, A.; Wilcockson, D.C.; Audsley, N.; Down, R.E.; Lafont, R.; Webster, S.G. Functional characterization and signaling systems of Corazonin and red pigment concentrating hormone in the green shore crab, Carcinus maenas . Front. Neurosci. 2018 , 11 , 752. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Veenstra, J.A. Does Corazonin signal nutritional stress in insects? Insect. Biochem. Mol. Biol. 2009 , 39 , 755–762. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Kim, Y.J.; Spalovská-Valachová, I.; Cho, K.H.; Zitnanova, I.; Park, Y.; Adams, M.E.; Žitňan, D. Corazonin receptor signaling in ecdysis initiation. Proc. Natl. Acad. Sci. USA 2004 , 101 , 6704–6709. [ Google Scholar ] [ CrossRef ]
  • Gospocic, J.; Shields, E.J.; Glastad, K.M.; Lin, Y.; Penick, C.A.; Yan, H.; Mikheyev, A.S.; Linksvayer, T.A.; Garcia, B.A.; Berger, S.L.; et al. The Neuropeptide Corazonin controls social behavior and caste identity in ants. Cell 2017 , 170 , 748–759. [ Google Scholar ] [ CrossRef ]
  • Varga, K.; Nagy, P.; Arsikin Csordás, K.; Kovács, A.L.; Hegedűs, K.; Juhász, G. Loss of Atg16 delays the alcohol-induced sedation response via regulation of Corazonin neuropeptide production in Drosophila. Sci. Rep. 2016 , 6 , 34641. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Ben-Menahem, D. GnRH-Related Neurohormones in the fruit fly Drosophila melanogaster . Int. J. Mol. Sci. 2021 , 22 , 5035. [ Google Scholar ] [ CrossRef ]
  • Cheng, J.; Zhao, P.; Zhu, L.; Zhu, F.; Tian, Z.; Shen, Z.; Liu, X.; Liu, X. Corazonin signaling modulates the synthetic activity of male accessory gland in Grapholita molesta . Int. J. Biol. Macromol. 2022 , 216 , 446–455. [ Google Scholar ] [ CrossRef ]
  • Tu, S.; Ge, F.; Han, Y.; Wang, M.; Xie, X.; Zhu, D. Putative role of corazonin in the ovarian development of the swimming crab Portunus trituberculatus . Front. Mar. Sci. 2022 , 9 , 976754. [ Google Scholar ] [ CrossRef ]
  • Mykles, D.L. Signaling pathways that regulate the crustacean molting gland. Front. Endocrinol. 2021 , 12 , 674711. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Predel, R.; Neupert, S.; Russell, W.K.; Scheibner, O.; Nachman, R.J. Corazonin in insects. Peptides 2007 , 28 , 3–10. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Veenstra, J.A. Similarities between decapod and insect neuropeptidomes. PeerJ 2016 , 4 , e2043. [ Google Scholar ] [ CrossRef ]
  • Kubrak, O.I.; Lushchak, O.V.; Zandawala, M.; Nässel, D.R. Systemic Corazonin signalling modulates stress responses and metabolism in Drosophila . Open Biol. 2016 , 6 , 160152. [ Google Scholar ] [ CrossRef ]
  • Sha, K.; Choi, S.-H.; Im, J.; Lee, G.G.; Loeffler, F.; Park, J.H. Regulation of ethanol-related behavior and ethanol metabolism by the Corazonin neurons and Corazonin receptor in Drosophila melanogaster . PLoS ONE 2014 , 9 , e87062. [ Google Scholar ] [ CrossRef ]
  • Buckley, S.J.; Nguyen, T.V.; Cummins, S.F.; Elizur, A.; Fitzgibbon, Q.P.; Smith, G.S.; Mykles, D.L.; Ventura, T. Evaluating conserved domains and motifs of decapod gonadotropin-releasing hormone G protein-coupled receptor superfamily. Front. Endocrinol. 2024 , 15 , 1348465. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Cazzamali, G.; Saxild, N.P.E.; Grimmelikhuijzen, C.J.P. Molecular cloning and functional expression of a Drosophila Corazonin receptor. Biochem. Biophys. Res. Commun. 2002 , 298 , 31–36. [ Google Scholar ] [ CrossRef ]
  • Belmont, M.; Cazzamali, G.; Williamson, M.; Hauser, F.; Grimmelikhuijzen, C.J.P. Identification of four evolutionarily related g protein-coupled receptors from the malaria mosquito Anopheles gambiae . Biochem. Biophys. Res. Commun. 2006 , 344 , 160–165. [ Google Scholar ] [ CrossRef ]
  • Yang, J.; Huang, H.; Yang, H.; He, X.; Jiang, X.; Shi, Y.; Alatangaole, D.; Shi, L.; Zhou, N. Specific activation of the g protein-coupled receptor bngr-a21 by the neuropeptide Corazonin from the silkworm, Bombyx mori , dually couples to the Gq and Gs signaling cascades. J. Biol. Chem. 2013 , 288 , 11662–11675. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Oryan, A.; Wahedi, A.; Paluzzi, J.P.V. Functional characterization and quantitative expression analysis of two GnRH-related peptide receptors in the mosquito, Aedes aegypti . Biochem. Biophys. Res. Commun. 2018 , 497 , 550–557. [ Google Scholar ] [ CrossRef ]
  • Sha, K.; Conner, W.C.; Choi, D.Y.; Park, J.H. Characterization, expression, and evolutionary aspects of Corazonin neuropeptide and its receptor from the house fly, Musca domestica (Diptera: Muscidae). Gene 2012 , 497 , 191–199. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Buckley, S.J.; Fitzgibbon, Q.P.; Smith, G.G.; Ventura, T. In silico prediction of the G-Protein coupled receptors expressed during the metamorphic molt of Sagmariasus Verreauxi (Crustacea: Decapoda) by mining transcriptomic data: RNA-Seq to repertoire. Gen. Comp. Endocrinol. 2016 , 228 , 111–127. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Tu, S.; Xu, R.; Wang, M.; Xie, X.; Bao, C.; Zhu, D. Identification and characterization of expression profiles of neuropeptides and their GPCRs in the swimming crab, Portunus trituberculatus . PeerJ 2021 , 9 , 12179. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Tran, N.M.; Mykles, D.L.; Elizur, A.; Ventura, T. Characterization of G-Protein coupled receptors from the blackback land crab Gecarcinus lateralis Y organ transcriptome over the molt cycle. BMC Genom. 2019 , 20 , 74. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Nguyen, T.V.; Rotllant, G.E.; Cummins, S.F.; Elizur, A.; Ventura, T. Insights into sexual maturation and reproduction in the norway lobster ( Nephrops norvegicus ) via in silico prediction and characterization of neuropeptides and G protein-coupled receptors. Front. Endocrinol. 2018 , 9 , 430. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Porras, M.G.; De Loof, A.; Breuer, M.; Aréchiga, H. Corazonin promotes tegumentary pigment migration in the crayfish Procambarus clarkii . Peptides 2003 , 24 , 1581–1589. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Minh Nhut, T.; Mykles, D.L.; Elizur, A.; Ventura, T. Ecdysis triggering hormone modulates molt behaviour in the redclaw crayfish Cherax quadricarinatus , providing a mechanistic evidence for conserved function in molt regulation across pancrustacea. Gen. Comp. Endocrinol. 2020 , 298 , 113556. [ Google Scholar ] [ CrossRef ]
  • Shen, J.; Zhu, D.; Hu, Z.; Qi, Y.; Wang, C. Molt staging in the swimming crab Portunus trituberculatus . J. Fish. China 2011 , 35 , 1481–1487. [ Google Scholar ] [ CrossRef ]
  • Reddy, P.R.; Nagaraju, G.P.C.; Reddy, P.S. Involvement of methyl farnesoate in the regulation of molting and reproduction in the freshwater crab Oziotelphusa senex senex . J. Crus. Biol. 2004 , 24 , 511–515. [ Google Scholar ] [ CrossRef ]
  • Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. Methods 2001 , 25 , 402–408. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Wang, C.J.; Zhu, D.F.; Qi, Y.Z.; Hu, Z.H.; Xie, X.; Shen, J. Molt-Inhibiting hormone levels and ecdysteroid titer during a molt cycle of Portunus trituberculatus . Acta Hydrobio. Sin. 2013 , 37 , 22–28. [ Google Scholar ] [ CrossRef ]
  • Webster, S.G.; Keller, R.; Dircksen, H. The CHH-Superfamily of multifunctional peptide hormones controlling crustacean metabolism, osmoregulation, moulting, and reproduction. Gen. Comp. Endocrinol. 2012 , 175 , 217–233. [ Google Scholar ] [ CrossRef ]
  • Mykles, D.L.; Chang, E.S. Hormonal control of the crustacean molting gland: Insights from transcriptomics and proteomics. Gen. Comp. Endocrinol. 2020 , 294 , 113493. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Techa, S.; Thongda, W.; Bunphimpapha, P.; Ittarat, W.; Boonbangyang, M.; Wilantho, A.; Ngamphiw, C.; Pratoomchat, B.; Nounurai, P.; Piyapattanakorn, S. Isolation and functional identification of secretin family G-Protein coupled receptor from Y-organ of the mud crab, Scylla Olivacea . Gene 2023 , 848 , 146900. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Kannangara, J.R.; Christen, K.M.; Warr, C.G. Regulation of ecdysone production in Drosophila by neuropeptides and peptide hormones. Open Biol. 2021 , 11 , 200373. [ Google Scholar ] [ CrossRef ]
  • Mykles, D.L. Ecdysteroid metabolism in crustaceans. J. Steroid. Biochem. Mol. Biol. 2011 , 127 , 196–203. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Xie, X.; Liu, Z.; Liu, M.; Tao, T.; Shen, X.; Zhu, D. Role of Halloween genes in ecdysteroids biosynthesis of the swimming crab ( Portunus trituberculatus ): Implications from RNA interference and eyestalk ablation. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2016 , 199 , 105–110. [ Google Scholar ] [ CrossRef ]
  • Zhao, Y.F.; Wen, Q.Q.; Ao, C.M.; Wang, W.; Shi, L.L.; Wang, C.G.; Chan, S.F. Ecdysis triggering hormone, eclosion hormone, and crustacean cardioactive peptide play essential but different roles in the molting process of mud crab, Scylla paramamosain . Front. Mar. Sci. 2022 , 9 , 855391. [ Google Scholar ] [ CrossRef ]
  • Chan, S.F.; Wen, Q.Q.; Ao, C.M.; Wang, W.; Wang, C.G.; Zhao, Y.F. Transcriptome responses of RNAi-mediated ETH knockdown in Scylla paramamosain at different premolt substages. Front. Endocrinol. 2022 , 13 , 917088. [ Google Scholar ] [ CrossRef ]

Click here to enlarge figure

GenePrimer (5′-3′)GenBank Accession No.
PtCrzForward: CAGTTGTGGTGCTCGTTGCCOL694705
Reverse: GCTCAGCGGACCTTTTTCG
PtCrzRForward: GTCATCTGCTGGACTCCCTACTACOL694706
Reverse: CGGGTTGACGAGACTGTTGG
PtSpoForward: GTTTTGGCTCCCGCAACTAKM030021
Reverse: TGTCGTCGGTGAGGCTTGT
PtSadForward: CAGATATGGGCAGATTCATCGKM596851
Reverse: AAGGCGTCATCCAGGCAC
PtDibForward: GGCAAACACTGGTGGGAACTKM880023
Reverse: ACCCTTCACGCCTCATCTTG
PtETHForward: ATGCTCTCTGTTCTGGACTCAAGMT890695
Reverse: TCACTTCTGCAGGTAACGCA
β-actinForward: CGAAACCTTCAACACTCCCGFI641977
Reverse: CGGGTTGACGAGACTGTTGG
The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

Xie, X.; Zhang, J.; Tu, S.; Zhou, Q.; Zhu, D. Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus . Biology 2024 , 13 , 630. https://doi.org/10.3390/biology13080630

Xie X, Zhang J, Tu S, Zhou Q, Zhu D. Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus . Biology . 2024; 13(8):630. https://doi.org/10.3390/biology13080630

Xie, Xi, Jun Zhang, Shisheng Tu, Qi Zhou, and Dongfa Zhu. 2024. "Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus " Biology 13, no. 8: 630. https://doi.org/10.3390/biology13080630

Article Metrics

Supplementary material.

ZIP-Document (ZIP, 218 KiB)

Further Information

Mdpi initiatives, follow mdpi.

MDPI

Subscribe to receive issue release notifications and newsletters from MDPI journals

IMAGES

  1. How to Write a Synthesis Essay: Examples, Topics, & Synthesis Essay Outline

    what is the synthesis in an essay

  2. How to Write a Synthesis Essay: Examples, Topics, & Synthesis Essay Outline

    what is the synthesis in an essay

  3. How to Write a Synthesis Essay Guide by EssayHub

    what is the synthesis in an essay

  4. How to write a Synthesis Essay

    what is the synthesis in an essay

  5. How to Write a Synthesis Essay

    what is the synthesis in an essay

  6. Synthesis Essay

    what is the synthesis in an essay

COMMENTS

  1. How to Write a Synthesis Essay, WIth Examples

    Synthesis essay structure 1: By topic. The first kind of synthesis essay structure involves discussing each topic individually, mentioning each source's perspective on it, and then moving on to the next topic. This approach lets you compare or join together points made by different sources about the same specific topic.

  2. Guide to Synthesis Essays: How to Write a Synthesis Essay

    Synthesis essay writing involves a great deal of intellectual work, but knowing how to compose a compelling written discussion of a topic can give you an edge in many fields, from the social sciences to engineering. The writing process for composing a good synthesis essay requires curiosity, research, and original thought to argue a certain ...

  3. Synthesis Essays: A Step-by-Step How-To Guide

    How to write body paragraphs for synthesis essays: 1.Pick three points to write about from your list of points about which the writers agreed or disagreed. When picking three to write about, pick the three that offer you ample evidence. 2.Decide the order of the three points to be written about in your body paragraphs.

  4. How to Write a Synthesis Essay: Your Guide From Start to Finish

    Synthesis essay is an academic assignment where you take information from several sources and combine it to create a new, unified argument. Throughout the essay, you'll weave in evidence and insights from your sources to support your thesis, explaining how each source contributes to your overall argument.

  5. Synthesis Essay

    A synthesis essay is a written work that takes a unique viewpoint about a central idea, theme, or topic, and backs it up with a combination of multiple sources. The process has four major components:

  6. How to Write a Synthesis Essay

    Your essay should have an introductory paragraph that includes your thesis, a body to present evidence that supports your thesis, and a conclusion that summarizes your point of view. 2. Write in the third person. Writing in the third person means using "he," "she," "it", and using complete, unambiguous sentences.

  7. How to Write a Synthesis Essay

    A synthesis essay gathers ideas and viewpoints from several different sources and ties them together to form a new concept. How long is a synthesis essay? Synthesis essays usually follow the five-paragraph format, with an introduction, three main body paragraphs discussing different points, and a conclusion.

  8. How to Write a Synthesis Essay: Outline Example and Tips from Pros

    Make a Synthesis Essay Outline to Structure Content. Earlier, we emphasized the importance of orchestrating your main content under study. This section covers the crucial thing in writing a synthesis essay: an outline. The outline is a great synthesis essay template for structuring your entire paper. We recommend you always stick to it once you ...

  9. Full Guide to Synthesis Essays: How to Write a Synthesis Essay

    A synthesis essay is a type of academic writing that focuses on combining information from several sources to create an argument or a perspective on a given topic.

  10. PDF Writing a Synthesis Essay

    3. Tips for an effective synthesis essay: • Establish your purpose to shape the way you want to argue and form your thesis. The thesis is the main claim or idea of your essay. • Select your sources and become familiar with them so that you can discuss them in relationship to your thesis and supporting argument(s).

  11. Synthesis

    In a summary, you share the key points from an individual source and then move on and summarize another source. In synthesis, you need to combine the information from those multiple sources and add your own analysis of the literature. This means that each of your paragraphs will include multiple sources and citations, as well as your own ideas ...

  12. 27 How do I Write a Synthesis Essay?

    Synthesis essays will typically contain three body paragraphs. A good body paragraph contains three main sections: a topic sentence (or key sentence), relevant supporting sentences, and a closing (or transition) sentence. This structure keeps your paragraph focused on the main idea, providing clear, concise information.

  13. How to Write a Synthesis Essay: Examples, Topics, & Outline

    A synthesis matrix will help you with that: Find several central ideas in the chart. Choose the ones that are repeated the most often and the ones that you feel need to be in your essay. Combine them, and you have a thesis statement with all the key points. Make a draft of the thesis statement.

  14. Guide to Writing a Synthesis Essay: Tips and Examples

    A synthesis essay is a unique form of academic writing that requires students to combine information from multiple sources to support a thesis statement. In this type of essay, the writer needs to analyze various perspectives and synthesize them into a coherent argument.

  15. How to write a good AP synthesis essay

    A synthesis essay uses information from multiple sources to support an argument or explanation. Overview of Synthesis Essay Writing. First, take some time to develop a thorough understanding of what you will be writing about. Take notes as you go, keeping track of points you want to make and evidence you want to include in the essay.

  16. How To Write Synthesis In Research: Example Steps

    Step 1 Organize your sources. Step 2 Outline your structure. Step 3 Write paragraphs with topic sentences. Step 4 Revise, edit and proofread. When you write a literature review or essay, you have to go beyond just summarizing the articles you've read - you need to synthesize the literature to show how it all fits together (and how your own ...

  17. How To Write a Good Synthesis Essay (Plus 7 Steps and Tips)

    A synthesis essay is an essay you may need to write that uses multiple sources. Similar to other essays, a professor may assign certain readings to you or you may find them on your own. To synthesize sources, it means to explore what each is saying and how they contribute to your own thesis. As the thesis is the statement explaining the purpose ...

  18. Academic Guides: Evidence-Based Arguments: Synthesis

    Synthesis is different from summary. Summary consists of a brief description of one idea, piece of text, etc. Synthesis involves combining ideas together. Summary: Overview of important general information in your own words and sentence structure. Paraphrase: Articulation of a specific passage or idea in your own words and sentence structure.

  19. How to Write a Synthesis Essay: Step-by-Step Guide

    A synthesis essay's purpose is to establish meaningful connections between sections of a work. When conducting research on a topic, you have to look for connections to build a strong viewpoint on the subject. The ultimate goal of the essay is to present and prove a claim about a topic. Select a Topic Appropriate for a Synthesis Essay

  20. Well-Written Synthesis Essay Examples

    Get multiple synthesis essay examples covering a range of topics. Learn how to craft an introduction, thesis, outlines, or write your entire synthesis essay.

  21. Synthesis

    Basics of Synthesis. As you incorporate published writing into your own writing, you should aim for synthesis of the material. Synthesizing requires critical reading and thinking in order to compare different material, highlighting similarities, differences, and connections. When writers synthesize successfully, they present new ideas based on ...

  22. Synthesizing Sources

    Revised on May 31, 2023. Synthesizing sources involves combining the work of other scholars to provide new insights. It's a way of integrating sources that helps situate your work in relation to existing research. Synthesizing sources involves more than just summarizing. You must emphasize how each source contributes to current debates ...

  23. Tips for Writing an Effective Synthesis Essay

    Understand the Prompt. In order to write an effective synthesis essay, it is crucial to fully understand the prompt provided. The prompt serves as a guide, outlining the specific topic or issue that needs to be addressed in the essay. When analyzing the prompt, it is important to carefully examine the keywords and phrases used.

  24. Key Concepts in Video Synthesis

    LFOs play a similar role in video synthesis as they do with audio synthesis — they produce regular (repeating, rhythmic) changes at a very low frequency such that the changes can actually be perceived. E.g. a 2 Hz LFO will produce a sonic or visual rhythm twice per second, which is audible or visible as a repeating change of some kind.

  25. 'A Crisis Coming': The Twin Threats to American Democracy

    The United States faces two distinct challenges, the movement by Republicans who refuse to accept defeat in an election and a growing disconnect between political power and public opinion.

  26. New twist on synthesis technique promises sustainable manufacturing

    Rice University. (2024, August 16). New twist on synthesis technique promises sustainable manufacturing. ScienceDaily.Retrieved August 17, 2024 from www.sciencedaily.com / releases / 2024 / 08 ...

  27. Photocatalytic Synthesis of Glycine from Methanol and Nitrate

    Photocatalytic utilization of methanol and nitrate as carbon and nitrogen sources for the direct synthesis of amino acids could provide a sustainable way for the valorization of green "liquid sunlight" and nitrate waste. In this study, we developed an efficient photochemical method to synthesize glycine directly from methanol and nitrate ...

  28. PDF Distinct Mechanisms of Type 3 Secretion System Recognition ...

    158 synthesis, but alternave mechanisms are required for T3SS -induced LTB 4 synthesis in macrophages. STIM1-mediated flux of extracellular Ca2+ is required for LTB 4159 synthesis in both neutrophils and macrophages 160 PLC-mediated Ca2+ flux is required for LTB 4 synthesis in neutrophils, but PLC signaling can lead to both Ca 2+ efflux from

  29. Efficient circular RNA synthesis through Gap-DNA splint-mediated

    The COVID-19 pandemic heightened interest in circular RNA (C-RNA) for RNA therapeutics, offering advantages over linear mRNAs. Circular mRNA facilitates uncapped molecule development, and C-RNAs ensure stability in RNA interference therapeutics. The synthesis method, RNA ligation, is employed in C-RNA-based therape

  30. Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process

    The neuropeptide corazonin (Crz) exerts diverse physiological effects in insects, yet its role in crustaceans remains elusive. The abundant expression of Crz receptor (CrzR) in the Y-organs of several crustaceans suggests a potential involvement of Crz in regulating ecdysteroid synthesis. In this study, we examined the effects of PtCrz on ecdysteroid synthesis during the molting period of ...